FAD1, FAD1 (gene) Fragaria x ananassa

Gene Overview
Name FAD1
Gene Symbol FAD1
Type gene
Organism Fragaria x ananassa
Synonym delta-12 fatty acid desaturase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
FAD1KF887973.1-FAD1.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
omega-6 fatty acid desaturaseFADFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KF887973.1-FAD1.m1 N/A KF887973.1

Sequence(s):
>KF887973.1-FAD1.m11128
atgggagccgataccaagttcgaagagcaaataaggacacgtcaaaggctgccggtttcgactccgccattcactctaag
ccaactcaagaaagccatacctccacattgcttcaagcgctctctcctccgctccttctcctatgtcatctacgacctcg
tcttggtctctctcttctaccacatcgccacctcttacttccacctcatccctcatcccctctcctacatcgcatggcca
gtctattggattctccaaggctgcaccctcaccggcgtgtgggtcatcgcacacgagtgtgggcaccacgccttcagtga
ctaccagctcttagacgacgtcattggccttgttcttcactcagctctgttggtcccttacttctcgtggaaatacagtc
acagacgccaccattccaacatcggatcgatggagagagatgaagcctttgttcctaaacccaaatctaagatctcatgg
tacaacaaatacttcaacaatccaccaggcaggttgatcactattatcttcaccctcaccctcggttggccgttgtactt
ggcatttaacgtctccggtcgaccctacgaccgtttcgcctgccactatgacccttacagtcccatattttccgaccgag
aaagccttcaaatatatatctccgatctcggaattttagtcactgcttctgtactctaccgccttgcaatggctaaggga
ttgacttggctcgtacgtgtttatggggtgcccttactgataacaaacgggtttcttgtgttgatcacatatttgcagca
cacacacccttcactgccacactacgactcgtcggagtgggattggttgcgaggagctttgtcgaccgtggatagagact
gcggggtgctccataaggttttccataatattacagacacacatgttgttcatcatctcttctctacgattccacattat
aatgcaatggaggccacaacagcagtgaagcctatattgggagattactatggttttgatgggactccgatttacaaggc
tttgtggagggaggctagggagtgcctttatgttgagccggatgaagatgctcctaataccaaaggtgttttttggtacc
ggaactaa
back to top