FAD2, FAD2 (gene) Malus baccata

Gene Overview
Name FAD2
Gene Symbol FAD2
Type gene
Organism Malus baccata
Synonym endoplasmic reticulum 18:1 desaturase
Description NA
Comment MbFAD2
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
FAD2KC702671.1-FAD2.m1Malus baccatamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
omega-6 fatty acid desaturaseFADMalus baccatagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly KC702671.1-FAD2.m1 Chr12:6578244..6579393
chr9:10738062..10739211
chr9:11322768..11323917
KC702671.1

Sequence(s):
>KC702671.1-FAD2.m11149
atgggtgccggtggaagaatggttgcgcctcctgtgcgcaaaaatgcggatgctgacacccacaagagagttccgtactc
taagcctccgttcagcctcggtgaggtcaagaaagccatcccacctcattgttttcagcgctctgttatccgctccttct
cctatgtcttttatgacctcaccattgcctctatcctttactacattgcttccacctacattcagaatctgtctcaacct
ctatccttcttggcatggccgattttctggtacgttcagggctgtgttctcaccggtgtttgggtcatagcacatgagtg
cggtcaccatgctttcagtgattatcaatggctggatgacactgttggtttgatcctccactcttgcctccttgtcccgt
acttctcatggaagtatagccatcgccgccaccattccaacacagcttcccttgagcgagatgaagtctttgtccccaag
cagaagttcgaaattggatggcatgccaaatatctcaacaatccgccaggcagattcctcacactcctcatccaactcac
tctaggctggcctttgtatcttgcgttcaatgtttctggaaggccctacaaaggatttgcttgccactttcatccgtatg
ggccaatctactctgatcgcgaacgattgcagatatttgtgtccgatgctggtgttcttgctgtcgtctatgggctttac
cgtcttgccgttgcaaaggggcttgcttgggttatatgcttctacggaggtcctctaatggtggtgaatggatttttggt
actgatcacgtacttgcagcacacccaccccgcattgccgcactatgattcctctgaatgggactggtttaggggagctt
tggccaccgttgacagagactacggaatcctgaacaaggttttccacaacatcacagacactcacgttgcgcaccatttg
ttctcaaccatgccgcactatcacgcaatggaggcgaccaaggcaatcaagccgatattgggcgagtactatcagttcga
cgggactccggtttacaaggcaatgtttagagaggcgaaggagtgtatctacgtcgagcccgatgagggtgccaagaaag
gtgtcttctggtacaataaaaagctgtga
back to top