FATB, FATB (gene) Prunus sibirica

Gene Overview
Name FATB
Gene Symbol FATB
Type gene
Organism Prunus sibirica
Synonym fatty acyl-ACP thioesterase B
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
FATBKM364595.1-FATB.m1Prunus sibiricamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
fatty acyl-ACP thioesteraseFATPrunus sibiricagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KM364595.1-FATB.m1 scaffold_7:20834018..20837306
KM364595.1

Sequence(s):
>KM364595.1-FATB.m11254
atggtcgccactgctgctacttcgtcgatctttccaattccttctccaaaccaagactctggtgccaaaaatgcgaagct
tggaactgggtctgctggtttaggactcaaatcgaaatctgcatcgggcagtttgcaggtaaaggcaaatgctcaagccc
cttcaaagataaatggcactagcgttggtttggcaactgttgaaagtgggaagaatggggatgacatgtcatcccctcct
gcgcggactttcattaaccaattacctgattggagtgtgctccttgctgctattaccacaatcttcttggctgcggagaa
gcaatggacgatgcttgattggaaacccaagcggcctgacatgcttattgacccatttggtttaggaagaattgttcagg
atggtcttgtcttccgccaaaacttctcaattagatcatatgaaataggtgctgatcgtacggcttcaatagagacgtta
atgaatcatttacaggaaacagcacttaatcatgttaagactgctgggcttttgggagatggctttggttcaacaccaga
gatgtcagtaaggaacctgatatgggtggtaactaaaatgcaggttgtagtagaccgctatcctacttggggtgacgttg
ttcaagttgacacttgggttagtgcctctgggaagaatggtatgcgtcgtgattggatcctccaggattgcaaaactggc
caaattttaacaagagccactagtgtgtgggtgatgatgaataagctgacgaggagattatccaaaattcctgatgaagt
tcgaggtgaaatagagcctttttttatgaattctcctcctgttgtggaggaggacagcaggaaactgctgaaacttgacg
acaagacagcggactttgttcgcactggtttaactcctaggtggggtgatttagatatcaaccagcatgttaataatgtg
aagtacattggctggatccttgagagtgctcccttgccaatcttggagagtcacgagctttcttctttgactctggagta
tagaagggagtgcgggcgggacagtgtgcttcagtccctgactgcagtctcaggtgctgatatcggcaatttgggaagca
atggcggcgttgagtgccagcacttgctccgacttgaggaaggagctgagattgtaaggggaaggactgagtggaggccc
aaatatgccaacaatcttgggattgtgggtcagcttccggcagaaagcgcttag
back to top