DREB, KM215612.1-DREB.m1 (mRNA) Prunus pseudocerasus

Transcript Overview
Unique NameKM215612.1-DREB.m1
OrganismPrunus pseudocerasus ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
DREBDREBPrunus pseudocerasusgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KM215612.1-DREB.m1-cds1KM215612.1-DREB.m1-cds1Prunus pseudocerasusCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
DREBKM215612.1-DREB.p1Prunus pseudocerasuspolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KM215612 region KM215612:49..768+ NCBI Rosaceae gene and mRNA sequences
Property NameValue
Productdehydration responsive element-binding protein
The following sequences are available for this feature:

mRNA sequence

>KM215612.1-DREB.m1 ID=KM215612.1-DREB.m1|Name=DREB|organism=Prunus pseudocerasus|type=mRNA|length=720bp
back to top

protein sequence of DREB

>KM215612.1-DREB.p1 ID=KM215612.1-DREB.p1|Name=DREB|organism=Prunus pseudocerasus|type=polypeptide|length=239bp
back to top

mRNA from alignment at KM215612:49..768+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KM215612.1-DREB.m1 ID=KM215612.1-DREB.m1|Name=DREB|organism=Prunus pseudocerasus|type=mRNA|length=720bp|location=Sequence derived from alignment at KM215612:49..768+ (Prunus pseudocerasus)
atggacatgttctccgctcagctttccaactcccccgaccagcccgagtc gagttctttctccgacgccagcgtcatcaccctaccggcttcttcctccg acgaaaacgtcatattggcgtcgagccggccgaagaagcgcgctgggagg agggttttcaaggagacgaggcacccggtttacaggggcgtgaggagaag gaacaacaacaagtgggtgtgtgagttgagagagcccaacaagaagaagt caagggtttggctcggaacgtatccaacggctgagatggctgctcgtgcc catgacgtggcggcattggcgttcagggggaagcttgcctgcataaactt tgctgactccgcatggcggctacccgtgccggcttccatggataccatgg atatccgaagggcagctgctgaggcggccgaagggttcaggccagaggag ttcggtggattatccagcgggagcagtgatgagaaggagataaatgttgt gatggaagagaagaagaagaattttagcgtggatatggaaataagcagca gcttgagcttgttttatttggatgaggaggaaatgtttgatatgccaagg ttgattgataacatggccgaagggcttcttctttctccacctcaatgctt agctggctacttgaactgggatgacatggaaactgaagctgatcccaaat tgtggagtttctcaatctga
back to top

Coding sequence (CDS) from alignment at KM215612:49..768+

>KM215612.1-DREB.m1 ID=KM215612.1-DREB.m1|Name=DREB|organism=Prunus pseudocerasus|type=CDS|length=720bp|location=Sequence derived from alignment at KM215612:49..768+ (Prunus pseudocerasus)
back to top