GAPDH-2, GAPDH-2 (gene) Pyrus pyrifolia var. culta

Gene Overview
Name GAPDH-2
Gene Symbol GAPDH-2
Type gene
Organism Pyrus pyrifolia var. culta
Synonym glyceraldehyde-3-phosphate dehydrogenase like protein
PsGAPDH-2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHPyrus pyrifolia var. cultagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDH-2AB266450.1-GAPDH-2.m1Pyrus pyrifolia var. cultamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB266450.1-GAPDH-2.m1 scaffold01427:48958..50473
AB266450.1

Sequence(s):
>AB266450.1-GAPDH-2.m1536
ggagctgagtacatcgttgagtcgaccggtgttttcaccgacaaggaaaaggctgctgcccatctgaagggtggagctaa
gaaagttatcatctcagcccccagcaaagacgctcctatgttcgttgtcggtgtcaatgagaaggactacatgaaagatc
ttgatattgtttccaatgctagttgcaccaccaactgccttgccccccttgcgaaggttattcatgatagattcggtatt
gtggagggtctgatgaccacagttcactccattactgccacccagaaaactgttgatggaccttcttcgaaggattggag
aggtggaagggcagcttcattcaacatcattcccagcagtactggagctgcaaaggctgttggtaaagtgctgcctgagc
tgaacggaaaattgacgggaatggcattccgtgttcctactgtcgatgtctcggtggttgaccttacagtgaggctggca
aaagcagctacttatgatgaagtaaaagctgctatcaaggaggagtctgaaggtaa
back to top