GAPDH1, GAPDH1 (gene) Fragaria x ananassa

Gene Overview
Name GAPDH1
Gene Symbol GAPDH1
Type gene
Organism Fragaria x ananassa
Synonym glyceraldehyde 3-phosphate dehydrogenase 1
glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDH1AF421492.1-GAPDH1Fragaria x ananassagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDH1AF421492.1-GAPDH1.m1Fragaria x ananassamRNA
GAPDH1AF421144.1-GAPDH1.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AF421492.1-GAPDH1 N/A AF421492.1
mRNA parsed from NCBI nr database AF421492.1-GAPDH1.m1 LG7:281764..282695
AF421492.1
mRNA parsed from NCBI nr database AF421144.1-GAPDH1.m1 LG7:281764..282695
AF421144.1

Sequence(s):
>AF421492.1-GAPDH1902
gcaactacaggtctctctctctatctctctcggtattgttgatcaattgattatggtattaacttgtcatggttttatac
gtgcagcaacacagaaaacagtcgatggcccatcaatgaaggattggagaggtggccgaggagctgctcagaatatcgtt
cctagttcgaccggtgctgcaaaggtagtttatagtagtgtggattctcattgatgtttcttccactggataattatatc
ttgatagcttgttagttattcactttcctcatcacaacgatctaatggccttttccctggaattttaggctgttggaaaa
gttctacctgaactcaatggaaagctgactggtatggccttccgtgtcccaactcctaatgtatctgttgtggacttaac
ttgtcgacttgagaagggtggttcttatgaggatgtcaaagcagccatcaggtatgtgtcggcatttttgtgtggtttta
gtgctcctttttggatttattaatcactgttgatatcttgttgaaggtatgctgctgatgggccacttagaggcattctg
ggatacaccgacgaagatgtggtttccaatgattttgttggtgactcaaggtaggatttcttttttttatgttcttctct
cgagatgagagtgaatatcgacatgaacctaaaaggtcagatgagtaattttatcatcactgatcgaccacaggatttat
gtttccagtcataattaatttactagaaggaaagattcgctgcatttagcatatgtagaccactgtcatctagttcaagt
acttgttctgagttatctcttttgcttaatcctttcaggtccagcatctttgatgccaaggctggattagcacttagttc
cacctttgttaagcttgtttcg
back to top
>AF421492.1-GAPDH1.m1399
gcaactacagcaacacagaaaacagtcgatggcccatcaatgaaggattggagaggtggccgaggagctgctcagaatat
cgttcctagttcgaccggtgctgcaaaggctgttggaaaagttctacctgaactcaatggaaagctgactggtatggcct
tccgtgtcccaactcctaatgtatctgttgtggacttaacttgtcgacttgagaagggtggttcttatgaggatgtcaaa
gcagccatcaggtatgctgctgatgggccacttagaggcattctgggatacaccgacgaagatgtggtttccaatgattt
tgttggtgactcaaggtccagcatctttgatgccaaggctggattagcacttagttccacctttgttaagcttgtttcg
back to top
>AF421144.1-GAPDH1.m1399
gcaactacagcaacacagaaaacagtcgatggcccatcaatgaaggattggagaggtggccgaggagctgctcagaatat
cattcctagttcaaccggtgctgcaaaggctgttggaaaagttctacctgaactcaacggaaagctgactggtatggcct
tccgtgtcccaactcctaatgtatctgttgtggacttaacttgtcgacttgagaagggtggttcttatgaggatgtcaaa
gcagccatcagatatgctgctgatgggccacttagaggcattctgggatacaccgatgaagatgtggtttccaatgattt
tgttggtgactcaaggtccagcatatttgatgccaaggctggattagcacttagttccacctttgttaagcttgtttcg
back to top