GAPDH, GAPDH (gene) Fragaria x ananassa

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Fragaria x ananassa
Synonym glyceraldehyde-3-phosphate dehydrogenase
FaGAPDH
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHFragaria x ananassagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHAB363963.1-GAPDH.m1Fragaria x ananassamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB363963.1-GAPDH.m1 N/A AB363963.1

Sequence(s):
>AB363963.1-GAPDH.m1500
attgttgtcgagtctactggagtgttcactgacaaggacaaagctgctgctcacttgaagggaggtgccaagaaggttgt
catctctgccccaagtaaggatgcccccatgttcgttgttggtgtgaatgagcacgaatacaagtctgacctttgcattg
tttccaatgctagttgcactaccaactgtcttgctccccttgccaaggttatcaacgacaggtttggaattgttgagggt
cttatgaccaccgtgcactccatcactgccacccagaagactgttgatggaccatcagccaaggactggagaggcggacg
tgctgcctcattcaacatcattcctagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggca
aattgaccggaatggccttccgtgtacccactgttgatgtttcagttgtcgacctcactgtcagacttgagaagaaggcc
acctatgaccagattaaggc
back to top