GAPDH, GAPDH (gene) Prunus armeniaca

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Prunus armeniaca
Synonym glyceraldehyde-3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHJN786944.1-GAPDH.m1Prunus armeniacamRNA
GAPDHJQ622232.1-GAPDH.m1Prunus armeniacamRNA


The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHJQ622232.1-GAPDHPrunus armeniacagene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHPrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JN786944.1-GAPDH.m1 scaffold_5:13923407..13926241
JN786944.1
gene parsed from NCBI nr database JQ622232.1-GAPDH N/A JQ622232.1
mRNA parsed from NCBI nr database JQ622232.1-GAPDH.m1 N/A JQ622232.1

Sequence(s):
>JN786944.1-GAPDH.m11014
atggggaagatcaagatcggaatcaacggatttggaaggatcggaaggttggtggccagagtggctctgcagagagatga
tattgaactcgtcgccattaacgatcctttcatcaccggcgactacatggtttacatgttcaactatgacactgtgcacg
gtcgctggaagcataacgatgtcaagcttagggacgcaaacacccttctctttggtgacaagcccgtctctatttttgct
gtcaggaacccagatgagatcccatggtctgggagtggagctgaatatgttgtcgagtcaaccggtgttttcaccgataa
ggaaaaggctgctgcccatttgaagggtggagcgaagaaggttatcatctcagcccccagcaaagacgctcctatgtttg
ttgtgggtgtcaatgagaaggaatacaagccagatcttaatattgtttccaatgctagttgcacgaccaactgccttgct
cctcttgcaaaggtcattcatgataggttcggtattgttgagggtctgatgaccaccgttcactccattactgccaccca
aaagactgtcgatggaccttcttctaaggattggagaggtggaagagctgcttcattcaacatcattcccagcagtactg
gagctgcaaaggctgttggtaaagtgctgcctgatctgaacggaaaattgacgggaatgtctttccgtgttcctactgtt
gatgtctcagtggttgaccttaccgtgaggctggcaaagtcagctacttatgatgaagtcaaagctgccatcaaggagga
gtctgagggaaaactgaagggaatcttgggttacactgaagatgacgtggtttccactgactttgttggggacagcaggt
ctagtatttttgatgcaaaggctggaattgctctgaatgataacttccacaagttggtctcatggtacgacaatgagtgg
ggatacagctctcgtgttgtcgacttgatttcctacattgcatctgttgattaa
back to top
>JQ622232.1-GAPDH530
ctgcttcattcaacatcattcccagcagtactggagctgcaaaggtaaaaaatgcatgtgatggtttttttagacccttc
catatttgataatggccttctttgttttttgtttcaatagtttactagttctcgactgtttgtactcttagttctgtaac
tcattatgtatcttggcctgcgaaggctgttggtaaagtgctgcctgaactgaacggaaaattgacgggaatgtctttcc
gtgttcctactgttgatgtctcagtggttgaccttaccgtgaggctggcaaagtcagctacttatgatgaagtcaaagct
gccatcaagtaagagtagagaagagttttcttgttcatattttaaatagctctttgtttaaccaatttattttgcggtca
ggaacttatggtggattacaaaatcttatcaaaactgtgtcttgataatgcttatctgcttgatttttttgttctctttc
acttgctaatatattatatggttcacagggaggagtctgagggaaaactg
back to top
>JQ622232.1-GAPDH.m1209
ctgcttcattcaacatcattcccagcagtactggagctgcaaaggctgttggtaaagtgctgcctgaactgaacggaaaa
ttgacgggaatgtctttccgtgttcctactgttgatgtctcagtggttgaccttaccgtgaggctggcaaagtcagctac
ttatgatgaagtcaaagctgccatcaaggaggagtctgagggaaaactg
back to top