GAPDH, GAPDH (gene) Rosa arkansana

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa arkansana
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091114.1-GAPDHRosa arkansanagene
GAPDHDQ091113.1-GAPDHRosa arkansanagene
GAPDHDQ091112.1-GAPDHRosa arkansanagene
GAPDHDQ091111.1-GAPDHRosa arkansanagene
GAPDHDQ091110.1-GAPDHRosa arkansanagene
GAPDHDQ091109.1-GAPDHRosa arkansanagene
GAPDHDQ091108.1-GAPDHRosa arkansanagene
GAPDHDQ091107.1-GAPDHRosa arkansanagene
GAPDHDQ091106.1-GAPDHRosa arkansanagene
GAPDHDQ091105.1-GAPDHRosa arkansanagene
GAPDHDQ091104.1-GAPDHRosa arkansanagene
GAPDHDQ091103.1-GAPDHRosa arkansanagene
GAPDHDQ091102.1-GAPDHRosa arkansanagene
GAPDHDQ091101.1-GAPDHRosa arkansanagene
GAPDHDQ091100.1-GAPDHRosa arkansanagene
GAPDHDQ091099.1-GAPDHRosa arkansanagene
GAPDHDQ091098.1-GAPDHRosa arkansanagene
GAPDHDQ091097.1-GAPDHRosa arkansanagene
GAPDHDQ091096.1-GAPDHRosa arkansanagene
GAPDHDQ091095.1-GAPDHRosa arkansanagene
GAPDHDQ091094.1-GAPDHRosa arkansanagene
GAPDHDQ091093.1-GAPDHRosa arkansanagene
GAPDHDQ091092.1-GAPDHRosa arkansanagene
GAPDHDQ091091.1-GAPDHRosa arkansanagene
GAPDHDQ091090.1-GAPDHRosa arkansanagene
GAPDHDQ091089.1-GAPDHRosa arkansanagene
GAPDHDQ091088.1-GAPDHRosa arkansanagene
GAPDHDQ091087.1-GAPDHRosa arkansanagene
GAPDHDQ091086.1-GAPDHRosa arkansanagene
GAPDHKM353249.1-GAPDHRosa arkansanagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091114.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091113.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091112.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091111.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091110.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091109.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091108.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091107.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091106.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091105.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091104.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091103.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091102.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091101.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091100.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091099.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091098.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091097.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091096.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091095.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091094.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091093.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091092.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091091.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091090.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091089.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091088.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091087.1-GAPDH.m1Rosa arkansanamRNA
GAPDHDQ091086.1-GAPDH.m1Rosa arkansanamRNA
GAPDHKM353249.1-GAPDH.m1Rosa arkansanamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa arkansanagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ091114.1-GAPDH N/A DQ091114.1
gene parsed from NCBI nr database DQ091113.1-GAPDH N/A DQ091113.1
gene parsed from NCBI nr database DQ091112.1-GAPDH N/A DQ091112.1
gene parsed from NCBI nr database DQ091111.1-GAPDH N/A DQ091111.1
gene parsed from NCBI nr database DQ091110.1-GAPDH N/A DQ091110.1
gene parsed from NCBI nr database DQ091109.1-GAPDH N/A DQ091109.1
gene parsed from NCBI nr database DQ091108.1-GAPDH N/A DQ091108.1
gene parsed from NCBI nr database DQ091107.1-GAPDH N/A DQ091107.1
gene parsed from NCBI nr database DQ091106.1-GAPDH N/A DQ091106.1
gene parsed from NCBI nr database DQ091105.1-GAPDH N/A DQ091105.1
gene parsed from NCBI nr database DQ091104.1-GAPDH N/A DQ091104.1
gene parsed from NCBI nr database DQ091103.1-GAPDH N/A DQ091103.1
gene parsed from NCBI nr database DQ091102.1-GAPDH N/A DQ091102.1
gene parsed from NCBI nr database DQ091101.1-GAPDH N/A DQ091101.1
gene parsed from NCBI nr database DQ091100.1-GAPDH N/A DQ091100.1
gene parsed from NCBI nr database DQ091099.1-GAPDH N/A DQ091099.1
gene parsed from NCBI nr database DQ091098.1-GAPDH N/A DQ091098.1
gene parsed from NCBI nr database DQ091097.1-GAPDH N/A DQ091097.1
gene parsed from NCBI nr database DQ091096.1-GAPDH N/A DQ091096.1
gene parsed from NCBI nr database DQ091095.1-GAPDH N/A DQ091095.1
gene parsed from NCBI nr database DQ091094.1-GAPDH N/A DQ091094.1
gene parsed from NCBI nr database DQ091093.1-GAPDH N/A DQ091093.1
gene parsed from NCBI nr database DQ091092.1-GAPDH N/A DQ091092.1
gene parsed from NCBI nr database DQ091091.1-GAPDH N/A DQ091091.1
gene parsed from NCBI nr database DQ091090.1-GAPDH N/A DQ091090.1
gene parsed from NCBI nr database DQ091089.1-GAPDH N/A DQ091089.1
gene parsed from NCBI nr database DQ091088.1-GAPDH N/A DQ091088.1
gene parsed from NCBI nr database DQ091087.1-GAPDH N/A DQ091087.1
gene parsed from NCBI nr database DQ091086.1-GAPDH N/A DQ091086.1
mRNA parsed from NCBI nr database DQ091114.1-GAPDH.m1 N/A DQ091114.1
mRNA parsed from NCBI nr database DQ091113.1-GAPDH.m1 N/A DQ091113.1
mRNA parsed from NCBI nr database DQ091112.1-GAPDH.m1 N/A DQ091112.1
mRNA parsed from NCBI nr database DQ091111.1-GAPDH.m1 N/A DQ091111.1
mRNA parsed from NCBI nr database DQ091110.1-GAPDH.m1 N/A DQ091110.1
mRNA parsed from NCBI nr database DQ091109.1-GAPDH.m1 N/A DQ091109.1
mRNA parsed from NCBI nr database DQ091108.1-GAPDH.m1 N/A DQ091108.1
mRNA parsed from NCBI nr database DQ091107.1-GAPDH.m1 N/A DQ091107.1
mRNA parsed from NCBI nr database DQ091106.1-GAPDH.m1 N/A DQ091106.1
mRNA parsed from NCBI nr database DQ091105.1-GAPDH.m1 N/A DQ091105.1
mRNA parsed from NCBI nr database DQ091104.1-GAPDH.m1 N/A DQ091104.1
mRNA parsed from NCBI nr database DQ091103.1-GAPDH.m1 N/A DQ091103.1
mRNA parsed from NCBI nr database DQ091102.1-GAPDH.m1 N/A DQ091102.1
mRNA parsed from NCBI nr database DQ091101.1-GAPDH.m1 N/A DQ091101.1
mRNA parsed from NCBI nr database DQ091100.1-GAPDH.m1 N/A DQ091100.1
mRNA parsed from NCBI nr database DQ091099.1-GAPDH.m1 N/A DQ091099.1
mRNA parsed from NCBI nr database DQ091098.1-GAPDH.m1 N/A DQ091098.1
mRNA parsed from NCBI nr database DQ091097.1-GAPDH.m1 N/A DQ091097.1
mRNA parsed from NCBI nr database DQ091096.1-GAPDH.m1 N/A DQ091096.1
mRNA parsed from NCBI nr database DQ091095.1-GAPDH.m1 N/A DQ091095.1
mRNA parsed from NCBI nr database DQ091094.1-GAPDH.m1 N/A DQ091094.1
mRNA parsed from NCBI nr database DQ091093.1-GAPDH.m1 N/A DQ091093.1
mRNA parsed from NCBI nr database DQ091092.1-GAPDH.m1 N/A DQ091092.1
mRNA parsed from NCBI nr database DQ091091.1-GAPDH.m1 N/A DQ091091.1
mRNA parsed from NCBI nr database DQ091090.1-GAPDH.m1 N/A DQ091090.1
mRNA parsed from NCBI nr database DQ091089.1-GAPDH.m1 N/A DQ091089.1
mRNA parsed from NCBI nr database DQ091088.1-GAPDH.m1 N/A DQ091088.1
mRNA parsed from NCBI nr database DQ091087.1-GAPDH.m1 N/A DQ091087.1
mRNA parsed from NCBI nr database DQ091086.1-GAPDH.m1 N/A DQ091086.1
gene parsed from NCBI nr database KM353249.1-GAPDH N/A KM353249.1
mRNA parsed from NCBI nr database KM353249.1-GAPDH.m1 N/A KM353249.1

Sequence(s):
>DQ091114.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
atgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtctcggttctaatcttttgtctttaattctgt
ctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091113.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
atgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgt
ctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091112.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgt
ctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091111.1-GAPDH758
catcactggtgagtttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcg
tctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcct
cattcaacatcattcccagcagcactggagctgccaaggtattctcaatattctttgtgccactgcttcagtattgttga
tacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatgtgtttaggctg
tcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgtt
gacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgt
tgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcatttgtctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgg
attagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091110.1-GAPDH780
gtcttatgactaccgtgcactccatcactggtgagtttttcacttgtaaccatgtgagatatatgaatgttaagatacta
gatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggac
tggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgt
gccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttg
attttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
agtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttc
taatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacaga
ataaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091109.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagcggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091108.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgcaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttaggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091107.1-GAPDH777
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagttgtatgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatggttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatgaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggat
gttgtgtcaactgacttcattggtgacaacaggtaaatgaatatttgtcatttaatggttggagtactacgtacagaata
aaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091106.1-GAPDH780
gtcttatgactaccgtgcactccatcactggtgagtttttcacttgtaaccatgtgagatatatgaatgttaagatacta
gatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggac
tggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattctcaatattctttgt
gccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttg
attttggaatgtgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
agtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttc
taatcatttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacaga
ataaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091105.1-GAPDH780
gtcttatgactaccgtgcactccatcactggtgagtttttcacttgtaaccatgtgagatatatgaatgttaagatacta
gatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggac
tggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgt
gccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttg
attttggaatgtgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
agtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttc
taatcatttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacaga
ataaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091104.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggcccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacgtgtctgtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091103.1-GAPDH749
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagttgtatgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatggttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatgaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttgtctttaattctgtctcaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgaca
acaggtaaatgaatatttgtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtggt
catcttgaagttgcagtggtgaatttatt
back to top
>DQ091102.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtatgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091101.1-GAPDH752
tggtgagtttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtg
tatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattca
acatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacact
tgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaa
aggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctc
actgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaa
ttagttgcaatcaaggtggggtgtcatgacattacaatgtatgtcttggttctaatcttttatctttaaatctgtctcaa
cagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagt
ggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091100.1-GAPDH752
tggtgagtttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtg
tatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattca
acatcattcccagcagcactggagctgccaaggtattctcaatattctttgtgccactgcttcagtattgttgatacact
tgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatgtgtttaggctgtcggaa
aggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctc
actgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaa
ttagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcatttgtctttaattctgtctcaa
cagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagt
ggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091099.1-GAPDH780
gtcttatgactaccgtgcactccatcactggtgagtttttcacttgtaaccatgtgagatatatgaatgttaagatacta
gatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggac
tggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattctcaatattctttgt
gccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttg
attttggaatgtgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
agtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttc
taatcatttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacaga
ataaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091098.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091097.1-GAPDH780
gtcttatgactaccgtgcactccatcactggtgagtttttcacttgtaaccatgtgagatatatgaatgttaagatacta
gatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggac
tggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgt
gccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttg
attttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
agtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgtatgtcttggttc
taatcttttatctttaaatctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacaga
ataaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091096.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtatgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091095.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttgcatgtcagtgattcttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggcgtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091094.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtatgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091093.1-GAPDH780
gtcttatgactaccgtgcactccatcactggtgagtttttcacttgtaaccatgtgagatatatgaatgttaagatacta
gatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggac
tggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgt
gccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttg
attttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
agtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgtatgtcttggttc
taatcttttatctttaaatctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacaga
ataaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091092.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgctacagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatctttcatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtaatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091091.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattctcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacgtgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091090.1-GAPDH780
gtcttatgactaccgtgcactccatcactggtgagtttttcacttgtaaccatgtgagatatatgaatgttaagatacta
gatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggac
tggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattctcaatattctttgt
gccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttg
attttggaatgtgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
agtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttc
taatcatttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacaga
ataaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091089.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggcccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacgtgtctgtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091088.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgcctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcctggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091087.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttgtctttaactctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091086.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagttgtatgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091114.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttca
ttggtgacaacag
back to top
>DQ091113.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttca
ttggtgacaacag
back to top
>DQ091112.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttca
ttggtgacaacag
back to top
>DQ091111.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttca
ttggtgacaacag
back to top
>DQ091110.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091109.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091108.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttaggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091107.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091106.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091105.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091104.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggcccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091103.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091102.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091101.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091100.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091099.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091098.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091097.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091096.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091095.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091094.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091093.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091092.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091091.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091090.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091089.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggcccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091088.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091087.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091086.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>KM353249.1-GAPDH726
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
atgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtctcggttctaatcttttgtctttaattctgt
ctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtg
back to top
>KM353249.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttca
ttggtgacaacag
back to top