GAPDH, GAPDH (gene) Rosa banksiae

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa banksiae
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575220.1-GAPDHRosa banksiaegene
GAPDHKJ575343.1-GAPDHRosa banksiaegene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575220.1-GAPDH.m1Rosa banksiaemRNA
GAPDHKJ575343.1-GAPDH.m1Rosa banksiaemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa banksiaegene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575220.1-GAPDH N/A GU575220.1
mRNA parsed from NCBI nr database GU575220.1-GAPDH.m1 N/A GU575220.1
gene parsed from NCBI nr database KJ575343.1-GAPDH N/A KJ575343.1
mRNA parsed from NCBI nr database KJ575343.1-GAPDH.m1 N/A KJ575343.1

Sequence(s):
>GU575220.1-GAPDH729
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtgaccatgtgtgagatatatgaatgttratcattt
gcatgttttgawactaactgaagttgtctgtgtatttgtaattcagccacccagaagactgttgatggaccatcagccaa
ggactggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattct
tcatgtgactgcttcagtattgttgatacatttttaagttaccatgtcaatgatacttcatctttaacagctttattaat
ccttgattttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggccttccgt
gtacccactgttgatgtttcagttgttgacctcactgtcaggcttgagaaggcggcaacctatgaccaaatcaaggctgc
tatcaagtaaggcttgttgaactttgttgttaatcagttgcaatcaagrtggggtgtcatgacattacaatgcatgtctt
ggttctaatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccg
atgaggatgttgtgtcaaccgacttcattggtgacagcaggtaaataaatattagtcattcaatggttggagtactatgt
acagaataa
back to top
>GU575220.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagccaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgactggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcaggcttgagaaggcgg
caacctatgaccaaatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacagcag
back to top
>KJ575343.1-GAPDH679
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtgaccatgtgtgagatatatgaatgttaatcattt
gcatgttttgaaactaactgaagttgtctgtgtatttgtaattcagccacccagaagactgttgatggaccatcagccaa
ggactggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattct
tcatgtgactgcttcagtattgttgatacatttttaagttacatgtcaatgatacttcatctttaacagctttattaatc
cttgattttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggccttccgtg
tacccactgttgatgtttcagttgttgacctcactgtcaggcttgagaaggcggcaacctatgaccaaatcaaggctgct
atcaagtaaggcttgttgaactttgttgttaatcagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttg
gttctaatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccga
tgaggatgttgtgtcaaccgacttcattggtgacagcag
back to top
>KJ575343.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagccaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgactggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcaggcttgagaaggcgg
caacctatgaccaaatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacagcag
back to top