GAPDH, GAPDH (gene) Rosa brunonii

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa brunonii
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575235.1-GAPDHRosa brunoniigene
GAPDHKM353253.1-GAPDHRosa brunoniigene
GAPDHKM353252.1-GAPDHRosa brunoniigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575235.1-GAPDH.m1Rosa brunoniimRNA
GAPDHKM353253.1-GAPDH.m1Rosa brunoniimRNA
GAPDHKM353252.1-GAPDH.m1Rosa brunoniimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa brunoniigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575235.1-GAPDH N/A GU575235.1
mRNA parsed from NCBI nr database GU575235.1-GAPDH.m1 N/A GU575235.1
gene parsed from NCBI nr database KM353253.1-GAPDH N/A KM353253.1
gene parsed from NCBI nr database KM353252.1-GAPDH N/A KM353252.1
mRNA parsed from NCBI nr database KM353253.1-GAPDH.m1 N/A KM353253.1
mRNA parsed from NCBI nr database KM353252.1-GAPDH.m1 N/A KM353252.1

Sequence(s):
>GU575235.1-GAPDH713
gtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtatttgcaattcagcca
cccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagcagc
actggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatrcacttktaagttacatgtcag
tgatacttsatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaaggttctgcctgctctc
aatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaa
gaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattwgttgcaatcaaggt
ggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctsaacagggaggagtctgagg
gaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaat
attagtcatttaatggttggagtrctacgtacagaataaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575235.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgac
aacag
back to top
>KM353253.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgatatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353252.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgatatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaatttgttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353253.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353252.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top