GAPDH, GAPDH (gene) Rosa canina

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa canina
Synonym cytosolic glyceraldehyde 3-phosphate dehydrogenase
glyceraldehyde 3-phosphate dehydrogenase
cGAPDH
Description essential for glycolysis
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHFR725970.1-GAPDHRosa caninagene
GAPDHFR725969.1-GAPDHRosa caninagene
GAPDHFR725968.1-GAPDHRosa caninagene
GAPDHFR725967.1-GAPDHRosa caninagene
GAPDHKJ575355.1-GAPDHRosa caninagene
GAPDHKJ575354.1-GAPDHRosa caninagene
GAPDHKJ575353.1-GAPDHRosa caninagene
GAPDHKJ575352.1-GAPDHRosa caninagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHFR725970.1-GAPDH.m1Rosa caninamRNA
GAPDHFR725969.1-GAPDH.m1Rosa caninamRNA
GAPDHFR725968.1-GAPDH.m1Rosa caninamRNA
GAPDHFR725967.1-GAPDH.m1Rosa caninamRNA
GAPDHKJ575355.1-GAPDH.m1Rosa caninamRNA
GAPDHKJ575354.1-GAPDH.m1Rosa caninamRNA
GAPDHKJ575353.1-GAPDH.m1Rosa caninamRNA
GAPDHKJ575352.1-GAPDH.m1Rosa caninamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa caninagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database FR725970.1-GAPDH N/A FR725970.1
gene parsed from NCBI nr database FR725969.1-GAPDH N/A FR725969.1
gene parsed from NCBI nr database FR725968.1-GAPDH N/A FR725968.1
gene parsed from NCBI nr database FR725967.1-GAPDH N/A FR725967.1
mRNA parsed from NCBI nr database FR725970.1-GAPDH.m1 N/A FR725970.1
mRNA parsed from NCBI nr database FR725969.1-GAPDH.m1 N/A FR725969.1
mRNA parsed from NCBI nr database FR725968.1-GAPDH.m1 N/A FR725968.1
mRNA parsed from NCBI nr database FR725967.1-GAPDH.m1 N/A FR725967.1
gene parsed from NCBI nr database KJ575355.1-GAPDH N/A KJ575355.1
gene parsed from NCBI nr database KJ575354.1-GAPDH N/A KJ575354.1
gene parsed from NCBI nr database KJ575353.1-GAPDH N/A KJ575353.1
gene parsed from NCBI nr database KJ575352.1-GAPDH N/A KJ575352.1
mRNA parsed from NCBI nr database KJ575355.1-GAPDH.m1 N/A KJ575355.1
mRNA parsed from NCBI nr database KJ575354.1-GAPDH.m1 N/A KJ575354.1
mRNA parsed from NCBI nr database KJ575353.1-GAPDH.m1 N/A KJ575353.1
mRNA parsed from NCBI nr database KJ575352.1-GAPDH.m1 N/A KJ575352.1

Sequence(s):
>FR725970.1-GAPDH1799
gccaagatcaagatcggaatcaacggtgagaatccagatccttgtttctttgaattgttgctttcggttgatatagatct
gagatttggcttggtttttggtttttggttttcgatctgatgaaaatgaaatggtgcaggattcggaagaatcggacgtt
tggttgctagggtcgccctacagagggacgatgttgagctcgtcgctgttaacgatccattcatcaccaccgactacatg
gtgagtgttaatctttgatgttttcggagttatatgagtttggatttttggaatattttgatgatcagtgtggtttttgt
tgtttttagacctacatgtttaagtatgacaccgtccacggagcatggaagcaccatgagctcaaggtcaaggatgagaa
gaccctcctcttcggtgagaggccagttgccgtcttcgggctcaggtattgatggatctctgagttattgattggtttga
gttggttttgtagttgctgtgattgtagatccaagtgctaattcaattgtgtgatttgtttgttgcagaaacccagagga
gatcccatggggttcggttggcgccgatattgttgtggagtctactggagtgttcactgacaaggacaaagccgccgctc
acttgaaggtcagctctctttacaatttttttcttctttaatttttgagttgattgcagtaccgtgtttgattggcttct
ctgctttggtgkatatatgattttgactctgtttctggtagtggatctttcggaattgatakttttgtggttgtgacaac
tttatggtygttttagagtgagtatgaagtatctttactagggactagtactgtcaatgagagagtgcatttaagacstg
aattgtatatrtttgttaatcatttgcatggttctctgtttatamttgattttaagtattatctccggtagggttagctg
tggtttattacgtgcatcccacttcttgatattgatttgggtagttctgcatctacattttgttacggakaattaatatg
tgctgcttgtgtgatcagggtggtgccaagaaggttgtcatctctgccccaagtaaggatgcccccatgtttgttgtggg
agtcaatgagcatgaatacaagtccgacctctgcattgtttccaatgctagctgcactaccaactgtcttgctccccttg
ccaaggttygcgtytttctgcytkytatttgtgtytgagaactcagccaattgttgttgcttatttaattttgttttgtt
gtctttaggttatcaacgacaggtttggaattgttgagggtcttatgactaccgtgcactccatcactggtgagttttca
cttgtaaccatgtgaggtatatgaatgttaagatactaggtttgaaaccaactaaagtcgtctgtgtatttgcaattcag
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggtattttcaatagtctttgtgccactgcttcagtattgttgatacacttttaagttacatgt
cagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaaggttctgcctgct
ctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttga
gaagaaggcaacctatgaccagatcaaggctgctatcaa
back to top
>FR725969.1-GAPDH1785
gccaagatcaagatcggaatcaacggtgagaatccagatccttgtttctttgaattgttgctttcggttgatatagatct
gagatttggcttggtttttggtttttagttttcgatctgatgaaaatgaaatggtgcaggattcggaagaatcggacgtt
tggttgctagggtcgccctacagagggacgatgttgagctcgtcgctgtcaacgatccattcatcaccaccgactacatg
gtgagtgttaatctttgatgttttcggagttatgagtttggatttttggaatattttgatgatcggtgtggtttttgttg
tttttagacctacatgtttaagtatgacaccgtccacggagcatggaagcacaatgagctcaaggtcaaggatgagaaga
ccctcctcttcggtgagaagccagtygccgtcttcgggctcaggtaatgatggatctctgagttattgattggtttgagt
tggttttgtagttgctgtgattgtagatccaagtgctaaatcaattgtgtgatttgtttgttgcagaaacccagaggaga
tcccatggggttcggttggcgccgatattgttgtggagtctactggagtgttcactgataaggacaaagccgccgctcac
ttgaaggtcagctctctttacaattttctttaatttttgagttgattgcagtaccgagtttgattggcttctctgctttg
gtgtatatatgattttgactgtgtttctagtagtggatctttcggaattgatatttttatggttgtgacaactttatggt
cattttagagtgagtatgaagtatctttactaggactggtactgtcaatgagagagtgcatttaagacgtgaattgtata
tatttgttaatcatttgcatggttctctgtttataattgattttaagtattatctccggtagggttagctgtggtttatt
acgtgcatcccacttcttgatattgatttgggtagttctgcatctacattttgttacggagaattaatatgtgctgcttg
tgtgatcagggtggtgccaagaaggttgtcatctctgccccaagtaaggatgcccccatgtttgttgtgggagtcaatga
gcatgaatacaagtccgacctttgcattgtttccaatgctagctgcactaccaactgtcttgctccccttgccaaggttt
gcgtctttctgcctgctatttgtgtctgagaactcagccaattgttgttgcttatttaattttgttgtctttaggttatc
aacgacaggtttggaattgttgagggtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtg
atatatatgaatgttaagatactagatttgaaaccaactaaagttgtctgtgtatttgcaattcagccacccagaagact
gttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgc
caaggtattttcaatattctttgtgccactgcttcagtattgttgatacacwtgtaagttacatgtcagtgatacttcat
ctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagtt
gaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacct
atgaccagatcaaggctgctatcaa
back to top
>FR725968.1-GAPDH1799
gccaagatcaagatcggaatcaacggtgagaatccagatccttgtttctttgaattgttgctttcggttgatatagatct
gagatttggcttggtttttggtttttagttttcggattttggttttcgatctgatgaaaatgaaatggtgcaggattcgg
aagaatcggacgtttggttgctagggtcgccctacagagggacgatgttgagctcgtcgctgtcaacgatccattcatca
ccaccgactacatggtgagtgttaatctttgatgttttcggagttatgagtttggatttttggaatattttgatgatcgg
tgtggtttttgttgtttttagacctacatgtttaagtatgacaccgtccacggagcatggaagcacaatgagctcaaggt
caaggatgagaagaccctcctcttcggtgagaagccagttgccgtcttcgggctcaggtaatgatggatctctgagttat
tgattggtttgagttggttttgtagttgctgtgattgtagatccaagtgctaaatcaattatgtgatttgtttgttgcag
aaacccagaggagatcccatggggttcggttggcgccgatattgttgtggagtctactggagtgttcactgacaaggaca
aagccgccgctcacttgaaggtcagctctctttacaattttctttactttttcagttgattgcagtaccgagtttgattg
gcttctctgctttggtgtatatatgattttgactgtgtttctagtagtggatctttcggaattgatatttttatggttgt
gacaactttatggtcattttagagtgagtatgaagtatctttactaggactagtactctcaatgagagagtgcatttaag
acctgaattgtatatatttgttaatcatttgcatggttctctgtttatacttgattttaagtattatctccggtagggtt
agctgtggtttattacgtgcatcccacttcttgatattgatttgggtagttctgcatctacattttgttacggagaatta
atatgtgctgcttgtgtgatcagggtggtgccaagaaggttgtcatctctgccccaagtaaggatgcccccatgtttgtt
gtgggagtcaatgagcatgaatacaagtccgacctttgcattgtttccaatgctagctgcactaccaactgtcttgctcc
ccttgccaaggtttgcgtctttctgcctgctatttgtgtttgagaactcagccaattgttgttgcttatttaattttgtt
gtctgtaggttatcaacgacaggtttggaattgttgagggtcttatgactaccgtgcactccatcastggtgagttttca
cttgtaaccatgtgagatatatgaatgttaagatactagattagaaaccaactaaagttgtctgtgtatttgcaattcag
ccacccagaagactgttratggaccatcagcaaaggactggagaggtggacgtgctgyctcgttcaacatcattcccagc
agcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacttttaagttacatgt
cagtgatacttcttctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaaggttctgcctgct
ctcaatggcaagttgaccggartggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttga
gaagaaggcaacctatgaccagatcaaggctgctatcaa
back to top
>FR725967.1-GAPDH1796
gccaagatcaagatcggaatcaacggtgagaatccagatccttctttctttgaattgttgctttcggttgatctagatct
gagatttggcttggtttttggttttcggattttggtttttgatctgatgaaaatgaaatggtgcaggattcggaagaatc
ggacgtttggtggctagggtcgccctacagagggacgatgttgagctcgtcgctgttaacgatccattcatcaccaccga
ctacatggtgagtgttaatctttgatgttttcggagttatgagtttgggatttttggaatattttgatgatcggtgtggt
ttttgttgtttttagacctacatgtttaagtatgacaccgtccacggagcatggaagcaccatgagctcaaggtcaagga
tgagaagaccctcctcttcggtgagaagccagttgccgtcttcgggctcaggtaatgatggatctctgagttattgattg
gtttgagttggttttgtagttgctgtgattgtagatccaagtgctaaatcaattgtgtgatttgtttgttgcagaaaccc
agaggagatcccatggggttcggttggcgccgatattgttgtggagtctactggagtgttcactgacaaggacaaagccg
ccgctcacttgaaggtcagctctctttacaatttttttcttctttaatttttgagttgattgcagtaccgtgtttgattg
gcttctctgctttggtgtatatatgattttgactctgtttctggtagtggatctttcggaattgatatttttgtggttgt
gacaactttatggtcgttttagagtgagtatgaagtatctttactagggactagtactgtcaatgagagagtgcatttaa
gacctgaattgtatatgtttgttaatcatttgcatggttctctgtttatacttgattttaagtattacctctggtagggt
tagctgtggatgcatctcacttcttgatattgatttgggtagttctgcatctacattttgttacggataattaatatgtg
ctgtttgtgtgatcagggtggtgccaagaaggttgtcatctctgccccaagtaaggatgcccccatgtttgttgtgggag
tcaatgagcatgaatacaagtcngacctttgcattgtttccaatgctagctgcactaccaactgtcttgctccccttgac
aaggttcgcgtctttctgccttctatttgtgtttgagaactcagccaattgttgttgcttatttaattttgttttgttgt
ctttaggttatcaacgacaggtttggaattgttgagggtcttatgactaccgtgcactccatcactggtgagttttcact
tgtaaccatgtgaggtatatgaatgttaaatactaggtttgaaaccaactaaagtcgtctgtgtatttgcaattcagcca
cccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagcagc
actggagctgccaaggtattttcaatagtctttgtgccactgcttcagtattgttgatacacttttaagttacatgtcag
tgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaaggttctgcctgctctc
aatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcaccgtcagacttgagaa
gaaggcaacctatgaccagatcaaggctgctatcaa
back to top
>FR725970.1-GAPDH.m1791
gccaagatcaagatcggaatcaacggattcggaagaatcggacgtttggttgctagggtcgccctacagagggacgatgt
tgagctcgtcgctgttaacgatccattcatcaccaccgactacatgacctacatgtttaagtatgacaccgtccacggag
catggaagcaccatgagctcaaggtcaaggatgagaagaccctcctcttcggtgagaggccagttgccgtcttcgggctc
agaaacccagaggagatcccatggggttcggttggcgccgatattgttgtggagtctactggagtgttcactgacaagga
caaagccgccgctcacttgaagggtggtgccaagaaggttgtcatctctgccccaagtaaggatgcccccatgtttgttg
tgggagtcaatgagcatgaatacaagtccgacctctgcattgtttccaatgctagctgcactaccaactgtcttgctccc
cttgccaaggttatcaacgacaggtttggaattgttgagggtcttatgactaccgtgcactccatcactgccacccagaa
gactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggag
ctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgat
gtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
back to top
>FR725969.1-GAPDH.m1791
gccaagatcaagatcggaatcaacggattcggaagaatcggacgtttggttgctagggtcgccctacagagggacgatgt
tgagctcgtcgctgtcaacgatccattcatcaccaccgactacatgacctacatgtttaagtatgacaccgtccacggag
catggaagcacaatgagctcaaggtcaaggatgagaagaccctcctcttcggtgagaagccagtygccgtcttcgggctc
agaaacccagaggagatcccatggggttcggttggcgccgatattgttgtggagtctactggagtgttcactgataagga
caaagccgccgctcacttgaagggtggtgccaagaaggttgtcatctctgccccaagtaaggatgcccccatgtttgttg
tgggagtcaatgagcatgaatacaagtccgacctttgcattgtttccaatgctagctgcactaccaactgtcttgctccc
cttgccaaggttatcaacgacaggtttggaattgttgagggtcttatgactaccgtgcactccatcactgccacccagaa
gactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggag
ctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgat
gtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
back to top
>FR725968.1-GAPDH.m1791
gccaagatcaagatcggaatcaacggattcggaagaatcggacgtttggttgctagggtcgccctacagagggacgatgt
tgagctcgtcgctgtcaacgatccattcatcaccaccgactacatgacctacatgtttaagtatgacaccgtccacggag
catggaagcacaatgagctcaaggtcaaggatgagaagaccctcctcttcggtgagaagccagttgccgtcttcgggctc
agaaacccagaggagatcccatggggttcggttggcgccgatattgttgtggagtctactggagtgttcactgacaagga
caaagccgccgctcacttgaagggtggtgccaagaaggttgtcatctctgccccaagtaaggatgcccccatgtttgttg
tgggagtcaatgagcatgaatacaagtccgacctttgcattgtttccaatgctagctgcactaccaactgtcttgctccc
cttgccaaggttatcaacgacaggtttggaattgttgagggtcttatgactaccgtgcactccatcastgccacccagaa
gactgttratggaccatcagcaaaggactggagaggtggacgtgctgyctcgttcaacatcattcccagcagcactggag
ctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggartggccttccgtgtacccactgttgat
gtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
back to top
>FR725967.1-GAPDH.m1791
gccaagatcaagatcggaatcaacggattcggaagaatcggacgtttggtggctagggtcgccctacagagggacgatgt
tgagctcgtcgctgttaacgatccattcatcaccaccgactacatgacctacatgtttaagtatgacaccgtccacggag
catggaagcaccatgagctcaaggtcaaggatgagaagaccctcctcttcggtgagaagccagttgccgtcttcgggctc
agaaacccagaggagatcccatggggttcggttggcgccgatattgttgtggagtctactggagtgttcactgacaagga
caaagccgccgctcacttgaagggtggtgccaagaaggttgtcatctctgccccaagtaaggatgcccccatgtttgttg
tgggagtcaatgagcatgaatacaagtcngacctttgcattgtttccaatgctagctgcactaccaactgtcttgctccc
cttgacaaggttatcaacgacaggtttggaattgttgagggtcttatgactaccgtgcactccatcactgccacccagaa
gactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggag
ctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgat
gtttcagttgttgacctcaccgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
back to top
>KJ575355.1-GAPDH674
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgatatatatgaatgttaagatactag
atttgaaaccaactaaagttgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacag
back to top
>KJ575354.1-GAPDH674
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
attagaaaccaactaaagttgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcgttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcttctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggtttt
aatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacag
back to top
>KJ575353.1-GAPDH673
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgaggtatatgaatgttaaatactagg
tttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactg
gagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatagtctttgtgc
cactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgat
tttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccca
ctgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaag
taaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttcta
atcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagga
tgttgtgtcaaccgacttcattggtgacaatag
back to top
>KJ575352.1-GAPDH673
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgaggtatatgaatgttaaatactagg
tttgaaaccaactaaagtcgtctgtgtgtttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactg
gagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgc
cactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgat
tttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccca
ctgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaag
taaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcacgtcttggttcta
atcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagga
tgttgtgtcaaccgacttcattggtgacaatag
back to top
>KJ575355.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>KJ575354.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcgttcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>KJ575353.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaatag
back to top
>KJ575352.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaatag
back to top