GAPDH, GAPDH (gene) Rosa carolina

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa carolina
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment glyceraldehyde 3-phosphate dehydrogenase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091144.1-GAPDHRosa carolinagene
GAPDHDQ091143.1-GAPDHRosa carolinagene
GAPDHDQ091142.1-GAPDHRosa carolinagene
GAPDHDQ091141.1-GAPDHRosa carolinagene
GAPDHDQ091140.1-GAPDHRosa carolinagene
GAPDHDQ091139.1-GAPDHRosa carolinagene
GAPDHDQ091138.1-GAPDHRosa carolinagene
GAPDHDQ091137.1-GAPDHRosa carolinagene
GAPDHDQ091136.1-GAPDHRosa carolinagene
GAPDHDQ091135.1-GAPDHRosa carolinagene
GAPDHDQ091134.1-GAPDHRosa carolinagene
GAPDHDQ091133.1-GAPDHRosa carolinagene
GAPDHDQ091132.1-GAPDHRosa carolinagene
GAPDHDQ091131.1-GAPDHRosa carolinagene
GAPDHDQ091130.1-GAPDHRosa carolinagene
GAPDHDQ091129.1-GAPDHRosa carolinagene
GAPDHDQ091128.1-GAPDHRosa carolinagene
GAPDHDQ091127.1-GAPDHRosa carolinagene
GAPDHDQ091126.1-GAPDHRosa carolinagene
GAPDHDQ091125.1-GAPDHRosa carolinagene
GAPDHDQ091124.1-GAPDHRosa carolinagene
GAPDHDQ091123.1-GAPDHRosa carolinagene
GAPDHDQ091122.1-GAPDHRosa carolinagene
GAPDHDQ091121.1-GAPDHRosa carolinagene
GAPDHDQ091120.1-GAPDHRosa carolinagene
GAPDHDQ091119.1-GAPDHRosa carolinagene
GAPDHDQ091118.1-GAPDHRosa carolinagene
GAPDHDQ091117.1-GAPDHRosa carolinagene
GAPDHDQ091116.1-GAPDHRosa carolinagene
GAPDHDQ091115.1-GAPDHRosa carolinagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091144.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091143.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091142.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091141.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091140.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091139.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091138.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091137.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091136.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091135.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091134.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091133.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091132.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091131.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091130.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091129.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091128.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091127.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091126.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091125.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091124.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091123.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091122.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091121.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091120.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091119.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091118.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091117.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091116.1-GAPDH.m1Rosa carolinamRNA
GAPDHDQ091115.1-GAPDH.m1Rosa carolinamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa carolinagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ091144.1-GAPDH N/A DQ091144.1
gene parsed from NCBI nr database DQ091143.1-GAPDH N/A DQ091143.1
gene parsed from NCBI nr database DQ091142.1-GAPDH N/A DQ091142.1
gene parsed from NCBI nr database DQ091141.1-GAPDH N/A DQ091141.1
gene parsed from NCBI nr database DQ091140.1-GAPDH N/A DQ091140.1
gene parsed from NCBI nr database DQ091139.1-GAPDH N/A DQ091139.1
gene parsed from NCBI nr database DQ091138.1-GAPDH N/A DQ091138.1
gene parsed from NCBI nr database DQ091137.1-GAPDH N/A DQ091137.1
gene parsed from NCBI nr database DQ091136.1-GAPDH N/A DQ091136.1
gene parsed from NCBI nr database DQ091135.1-GAPDH N/A DQ091135.1
gene parsed from NCBI nr database DQ091134.1-GAPDH N/A DQ091134.1
gene parsed from NCBI nr database DQ091133.1-GAPDH N/A DQ091133.1
gene parsed from NCBI nr database DQ091132.1-GAPDH N/A DQ091132.1
gene parsed from NCBI nr database DQ091131.1-GAPDH N/A DQ091131.1
gene parsed from NCBI nr database DQ091130.1-GAPDH N/A DQ091130.1
gene parsed from NCBI nr database DQ091129.1-GAPDH N/A DQ091129.1
gene parsed from NCBI nr database DQ091128.1-GAPDH N/A DQ091128.1
gene parsed from NCBI nr database DQ091127.1-GAPDH N/A DQ091127.1
gene parsed from NCBI nr database DQ091126.1-GAPDH N/A DQ091126.1
gene parsed from NCBI nr database DQ091125.1-GAPDH N/A DQ091125.1
gene parsed from NCBI nr database DQ091124.1-GAPDH N/A DQ091124.1
gene parsed from NCBI nr database DQ091123.1-GAPDH N/A DQ091123.1
gene parsed from NCBI nr database DQ091122.1-GAPDH N/A DQ091122.1
gene parsed from NCBI nr database DQ091121.1-GAPDH N/A DQ091121.1
gene parsed from NCBI nr database DQ091120.1-GAPDH N/A DQ091120.1
gene parsed from NCBI nr database DQ091119.1-GAPDH N/A DQ091119.1
gene parsed from NCBI nr database DQ091118.1-GAPDH N/A DQ091118.1
gene parsed from NCBI nr database DQ091117.1-GAPDH N/A DQ091117.1
gene parsed from NCBI nr database DQ091116.1-GAPDH N/A DQ091116.1
gene parsed from NCBI nr database DQ091115.1-GAPDH N/A DQ091115.1
mRNA parsed from NCBI nr database DQ091144.1-GAPDH.m1 N/A DQ091144.1
mRNA parsed from NCBI nr database DQ091143.1-GAPDH.m1 N/A DQ091143.1
mRNA parsed from NCBI nr database DQ091142.1-GAPDH.m1 N/A DQ091142.1
mRNA parsed from NCBI nr database DQ091141.1-GAPDH.m1 N/A DQ091141.1
mRNA parsed from NCBI nr database DQ091140.1-GAPDH.m1 N/A DQ091140.1
mRNA parsed from NCBI nr database DQ091139.1-GAPDH.m1 N/A DQ091139.1
mRNA parsed from NCBI nr database DQ091138.1-GAPDH.m1 N/A DQ091138.1
mRNA parsed from NCBI nr database DQ091137.1-GAPDH.m1 N/A DQ091137.1
mRNA parsed from NCBI nr database DQ091136.1-GAPDH.m1 N/A DQ091136.1
mRNA parsed from NCBI nr database DQ091135.1-GAPDH.m1 N/A DQ091135.1
mRNA parsed from NCBI nr database DQ091134.1-GAPDH.m1 N/A DQ091134.1
mRNA parsed from NCBI nr database DQ091133.1-GAPDH.m1 N/A DQ091133.1
mRNA parsed from NCBI nr database DQ091132.1-GAPDH.m1 N/A DQ091132.1
mRNA parsed from NCBI nr database DQ091131.1-GAPDH.m1 N/A DQ091131.1
mRNA parsed from NCBI nr database DQ091130.1-GAPDH.m1 N/A DQ091130.1
mRNA parsed from NCBI nr database DQ091129.1-GAPDH.m1 N/A DQ091129.1
mRNA parsed from NCBI nr database DQ091128.1-GAPDH.m1 N/A DQ091128.1
mRNA parsed from NCBI nr database DQ091127.1-GAPDH.m1 N/A DQ091127.1
mRNA parsed from NCBI nr database DQ091126.1-GAPDH.m1 N/A DQ091126.1
mRNA parsed from NCBI nr database DQ091125.1-GAPDH.m1 N/A DQ091125.1
mRNA parsed from NCBI nr database DQ091124.1-GAPDH.m1 N/A DQ091124.1
mRNA parsed from NCBI nr database DQ091123.1-GAPDH.m1 N/A DQ091123.1
mRNA parsed from NCBI nr database DQ091122.1-GAPDH.m1 N/A DQ091122.1
mRNA parsed from NCBI nr database DQ091121.1-GAPDH.m1 N/A DQ091121.1
mRNA parsed from NCBI nr database DQ091120.1-GAPDH.m1 N/A DQ091120.1
mRNA parsed from NCBI nr database DQ091119.1-GAPDH.m1 N/A DQ091119.1
mRNA parsed from NCBI nr database DQ091118.1-GAPDH.m1 N/A DQ091118.1
mRNA parsed from NCBI nr database DQ091117.1-GAPDH.m1 N/A DQ091117.1
mRNA parsed from NCBI nr database DQ091116.1-GAPDH.m1 N/A DQ091116.1
mRNA parsed from NCBI nr database DQ091115.1-GAPDH.m1 N/A DQ091115.1

Sequence(s):
>DQ091144.1-GAPDH754
cactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctc
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattgg
tgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggatta
gtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091143.1-GAPDH754
cactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctc
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattgg
tgacaacaggtaaatgaatattagtcatttaatggttgcagtactacgtacagaataaaccatctatgctgtttggatta
gtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091142.1-GAPDH754
cactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtatg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgtctc
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattgg
tgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggatta
gtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091141.1-GAPDH754
cactggtgagttttcacttgcaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctc
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattgg
tgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggatta
gtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091140.1-GAPDH751
tggtgagttttcacttgcaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091139.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091138.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgacgttgcagtggtgaatttatt
back to top
>DQ091137.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttgaaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091136.1-GAPDH756
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgttttgtgccactgcttcagtattgttgata
cacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgtc
tcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcatt
ggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggat
tagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091135.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgcctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091134.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgctacagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttactaatccttaattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatgttagtcatttaatggttggagtactacgtacagaataaaccgtctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091133.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgctacagtattgttgatacactt
gtaagttacatggcagtgatacttcatctttaacagctttattaatccttaattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatgttagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091132.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgacgttgcagtggtgaatttatt
back to top
>DQ091131.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttgcatgtcagtgattcttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggcgtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091130.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgacgttgcagtggtgaatttatt
back to top
>DQ091129.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtatgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaagcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgtatgtcttggttctaatcttttgtctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091128.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggcccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacgtgtctgtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091127.1-GAPDH749
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagttgtatgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatggttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattgtctcaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgaca
acaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtggt
catcttgaagttgcagtggtgaatttatt
back to top
>DQ091126.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttgcatgtcagtgattcttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091125.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgacggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttgcatgtcagtgattcttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggcgtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091124.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtatgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091123.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtatgtgt
atttgcaattcagccacccagaagactgttgatgaaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttgcatgtcagtgattcttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091122.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttgcatgtcagtgattcttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggcgtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091121.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgctacagtattgttgatacactt
gtaagttacatggcagtgatacttcatctttaacagctttattaatccttaattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatgttagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091120.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgcctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcctggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091119.1-GAPDH750
tggtgagttttcacttgtaactatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgac
aacaggtaaataaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtgg
tcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091118.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgacggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttgcatgtcagtgattcttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggcgtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091117.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagcg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091116.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtatgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaaccttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091115.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacta
gtaagttgcttgtcagtgattcttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatgttagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091144.1-GAPDH.m1330
cactgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattc
ccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgt
gtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgc
tatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattg
gtgacaacag
back to top
>DQ091143.1-GAPDH.m1330
cactgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattc
ccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgt
gtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgc
tatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattg
gtgacaacag
back to top
>DQ091142.1-GAPDH.m1330
cactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattc
ccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgt
gtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgc
tatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattg
gtgacaacag
back to top
>DQ091141.1-GAPDH.m1330
cactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattc
ccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgt
gtacccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgc
tatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattg
gtgacaacag
back to top
>DQ091140.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091139.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091138.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091137.1-GAPDH.m1327
tgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091136.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091135.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091134.1-GAPDH.m1327
tgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091133.1-GAPDH.m1327
tgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091132.1-GAPDH.m1327
tgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091131.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091130.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091129.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaagcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091128.1-GAPDH.m1327
tgccacccagaagactgttgatggcccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091127.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091126.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091125.1-GAPDH.m1327
tgccacccagaagactgttgacggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091124.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091123.1-GAPDH.m1327
tgccacccagaagactgttgatgaaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091122.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091121.1-GAPDH.m1327
tgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091120.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091119.1-GAPDH.m1326
tgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacag
back to top
>DQ091118.1-GAPDH.m1327
tgccacccagaagactgttgacggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091117.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091116.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091115.1-GAPDH.m1327
tgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top