GAPDH, GAPDH (gene) Rosa chinensis

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa chinensis
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575217.1-GAPDHRosa chinensisgene
GAPDHGU575216.1-GAPDHRosa chinensisgene
GAPDHGU575215.1-GAPDHRosa chinensisgene
GAPDHGU575214.1-GAPDHRosa chinensisgene
GAPDHGU575213.1-GAPDHRosa chinensisgene
GAPDHGU575212.1-GAPDHRosa chinensisgene
GAPDHGU575211.1-GAPDHRosa chinensisgene
GAPDHGU575210.1-GAPDHRosa chinensisgene
GAPDHGU575209.1-GAPDHRosa chinensisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575217.1-GAPDH.m1Rosa chinensismRNA
GAPDHGU575216.1-GAPDH.m1Rosa chinensismRNA
GAPDHGU575215.1-GAPDH.m1Rosa chinensismRNA
GAPDHGU575214.1-GAPDH.m1Rosa chinensismRNA
GAPDHGU575213.1-GAPDH.m1Rosa chinensismRNA
GAPDHGU575212.1-GAPDH.m1Rosa chinensismRNA
GAPDHGU575211.1-GAPDH.m1Rosa chinensismRNA
GAPDHGU575210.1-GAPDH.m1Rosa chinensismRNA
GAPDHGU575209.1-GAPDH.m1Rosa chinensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa chinensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575217.1-GAPDH N/A GU575217.1
gene parsed from NCBI nr database GU575216.1-GAPDH N/A GU575216.1
gene parsed from NCBI nr database GU575215.1-GAPDH N/A GU575215.1
gene parsed from NCBI nr database GU575214.1-GAPDH N/A GU575214.1
gene parsed from NCBI nr database GU575213.1-GAPDH N/A GU575213.1
gene parsed from NCBI nr database GU575212.1-GAPDH N/A GU575212.1
gene parsed from NCBI nr database GU575211.1-GAPDH N/A GU575211.1
gene parsed from NCBI nr database GU575210.1-GAPDH N/A GU575210.1
gene parsed from NCBI nr database GU575209.1-GAPDH N/A GU575209.1
mRNA parsed from NCBI nr database GU575217.1-GAPDH.m1 N/A GU575217.1
mRNA parsed from NCBI nr database GU575216.1-GAPDH.m1 N/A GU575216.1
mRNA parsed from NCBI nr database GU575215.1-GAPDH.m1 N/A GU575215.1
mRNA parsed from NCBI nr database GU575214.1-GAPDH.m1 N/A GU575214.1
mRNA parsed from NCBI nr database GU575213.1-GAPDH.m1 N/A GU575213.1
mRNA parsed from NCBI nr database GU575212.1-GAPDH.m1 N/A GU575212.1
mRNA parsed from NCBI nr database GU575211.1-GAPDH.m1 N/A GU575211.1
mRNA parsed from NCBI nr database GU575210.1-GAPDH.m1 N/A GU575210.1
mRNA parsed from NCBI nr database GU575209.1-GAPDH.m1 N/A GU575209.1

Sequence(s):
>GU575217.1-GAPDH610
tcagcaaaggactggagaggtgggcgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttc
aatattctttgtgccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctt
tattaatccttgattttggaatgtctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggc
cttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatca
aggctgctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtgaggtgtcatcacattacaatgc
atgtcttggttctaatcttttatctttaattctgtctgaacagggaggaatctgagggaaagttgaagggcatcttgggt
tacaccgatgaggatgttgtgtcaaccgacttcattggtgacaataggtaaatgaatattagtcacttaatggttggagt
actacgtacagaataagccatctatgctgtttggattagtgatcatcttg
back to top
>GU575216.1-GAPDH758
gtcttatgactactgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcaccggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaactttgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taatcgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gttgttgtgtcaaccgacttcattggtgacaacaggtaaatggatattagtcatttaatggtaggagtactacggacaga
ataaaccatctatgctgttcggattagtgatcaacttg
back to top
>GU575215.1-GAPDH712
tgtaaccatgtgagatatgaatgttaaatactagatttgaaaccaactaaagtcgtctgtgtattttgcaattcagccac
ccagaagactgttgatggaccgtcagcaaaggactggagaggtgggcgtgctgcctcattcaacatcattcccagcagca
ctggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacttttaagttacatgtcagt
gatacttcatctgtaacagctttattaatccttgattttggaatgtctttaggctgtcggaaaggttctgcctgctctca
atggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaag
aaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtg
gggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacagggaggaatctgaggg
aaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaataggtaaatgaata
ttagtcacttaatggttggagtactacgtacagaataagccatctatgctgtttggattagtgatcatcttg
back to top
>GU575214.1-GAPDH758
gtcttatgactactgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcaccggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaactttgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taatcgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacggacaga
ataaaccatctatgctgttcggattagtgatcaacttg
back to top
>GU575213.1-GAPDH755
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatgaatgttaaatactagatt
tgaaaccaactaaagtcgtctgtgtattttgcaattcagccacccagaagactgttgatggaccgtcagcaaaggactgg
agaggtgggcgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgcc
actgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgatt
ttggaatgtctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccac
tgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgatcagatcaaggctgctatcaagt
aaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaa
tcttttatctttaattctgtctgaacagggaggaatctgagggaaagttgaagggcatcttgggttacaccgatgaggat
gttgtgtcaaccgacttcattggtgacaataggtaaatgaatattagtcacttaatggttggagtactacgtacagaata
agccatctatgctgtttggattagtgatcatcttg
back to top
>GU575212.1-GAPDH738
cactccatcactggtgagttttcacttgtaaccatgtgagatatgaatgttaaatactagatttgaaaccaactaaagtc
gtctgtgtattttgcaattcagccacccagaagactgttgatggaccgtcagcaaaggactggagaggtgggcgtgctgc
ctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgtt
gatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatgtctttaggc
tgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttg
ttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaacttt
gttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattc
tgtctgaacagggaggaatctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgactt
cattggtgacaataggtaaatgaatattagtcacttaatggttggagtactacgtacagaataagccatctatgctgttt
ggattagtgatcatcttg
back to top
>GU575211.1-GAPDH755
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatgaatgttaaatactagatt
tgaaaccaactaaagtcgtctgtgtattttgcaattcagccacccagaagactgttgatggaccgtcagcaaaggactgg
agaggtgggcgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgcc
actgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgatt
ttggaatgtctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccac
tgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagt
aaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaa
tcttttatctttaattctgtctgaacagggaggaatctgagggaaagttgaagggcatcttgggttacaccgatgaggat
gttgtgtcaaccgacttcattggtgacaataggtaaatgaatattagtcacttaatggttggagtactacgtacagaata
agccatctatgctgtttggattagtgatcatcttg
back to top
>GU575210.1-GAPDH755
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatgaatgttaaatactagatt
tgaaaccaactaaagtcgtctgtgtattttgcaattcagccacccagaagactgttgatggaccgtcagcaaaggactgg
agaggtgggcgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgcc
actgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgatt
ttggaatgtctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccac
tgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagt
aaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaa
tcttttatctttaattctgtctgaacagggaggaatctgagggaaagttgaagggcatcttgggttacaccgatgaggat
gttgtgtcaaccgacttcattggtgacaataggtaaatgaatattagtcacttaatggttggagtactacgtacagaata
agccatctatgctgtttggattagtgatcatcttg
back to top
>GU575209.1-GAPDH755
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatacgaatgttaaatactagatt
tgaaaccaactaaagtcgtctgtgtattttgcaattcagccacccagaagactgttgatggaccgtcagcaaaggactgg
agaggtgggcgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgcc
actgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgatt
ttggaatgtctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggagtggccttccgtgtacccac
tgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagt
aaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaa
tcttttatctttaattctgtctgaacagggaggaatctgagggaaagttgaagggcatcttgggttacaccgatgaggat
gttgtgtcaaccgacttcattggtgacaataggtaaatgaatattagtcacttaatggttggagtactacgtacagaata
agccatctatgctgtttggattagtgatcatcttg
back to top
>GU575217.1-GAPDH.m1299
tcagcaaaggactggagaggtgggcgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggaatctgagggaaagttgaag
ggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaatag
back to top
>GU575216.1-GAPDH.m1355
gtcttatgactactgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcaccggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gttgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575215.1-GAPDH.m1325
ccacccagaagactgttgatggaccgtcagcaaaggactggagaggtgggcgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggaatctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgac
aatag
back to top
>GU575214.1-GAPDH.m1355
gtcttatgactactgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcaccggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575213.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccgtcagcaaaggactggagaggtggg
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgatcagatcaaggctgctatcaaggaggaatctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaatag
back to top
>GU575212.1-GAPDH.m1338
cactccatcactgccacccagaagactgttgatggaccgtcagcaaaggactggagaggtgggcgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatgg
ccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatc
aaggctgctatcaaggaggaatctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccga
cttcattggtgacaatag
back to top
>GU575211.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccgtcagcaaaggactggagaggtggg
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggaatctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaatag
back to top
>GU575210.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccgtcagcaaaggactggagaggtggg
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggaatctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaatag
back to top
>GU575209.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccgtcagcaaaggactggagaggtggg
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggagtggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggaatctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaatag
back to top