GAPDH, GAPDH (gene) Rosa chinensis var. spontanea

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa chinensis var. spontanea
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU564458.1-GAPDHRosa chinensis var. spontaneagene
GAPDHGU564457.1-GAPDHRosa chinensis var. spontaneagene
GAPDHGU564456.1-GAPDHRosa chinensis var. spontaneagene
GAPDHGU564455.1-GAPDHRosa chinensis var. spontaneagene
GAPDHGU564454.1-GAPDHRosa chinensis var. spontaneagene
GAPDHGU564453.1-GAPDHRosa chinensis var. spontaneagene
GAPDHKM353281.1-GAPDHRosa chinensis var. spontaneagene
GAPDHKM353280.1-GAPDHRosa chinensis var. spontaneagene
GAPDHKM353279.1-GAPDHRosa chinensis var. spontaneagene
GAPDHKM353278.1-GAPDHRosa chinensis var. spontaneagene
GAPDHKM353277.1-GAPDHRosa chinensis var. spontaneagene
GAPDHKM353276.1-GAPDHRosa chinensis var. spontaneagene
GAPDHKM353275.1-GAPDHRosa chinensis var. spontaneagene
GAPDHKM353274.1-GAPDHRosa chinensis var. spontaneagene
GAPDHKM353273.1-GAPDHRosa chinensis var. spontaneagene
GAPDHKM353272.1-GAPDHRosa chinensis var. spontaneagene
GAPDHKM353271.1-GAPDHRosa chinensis var. spontaneagene
GAPDHKM353270.1-GAPDHRosa chinensis var. spontaneagene
GAPDHKM353269.1-GAPDHRosa chinensis var. spontaneagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU564458.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHGU564457.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHGU564456.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHGU564455.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHGU564454.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHGU564453.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHKM353281.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHKM353280.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHKM353279.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHKM353278.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHKM353277.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHKM353276.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHKM353275.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHKM353274.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHKM353273.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHKM353272.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHKM353271.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHKM353270.1-GAPDH.m1Rosa chinensis var. spontaneamRNA
GAPDHKM353269.1-GAPDH.m1Rosa chinensis var. spontaneamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa chinensis var. spontaneagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU564458.1-GAPDH N/A GU564458.1
gene parsed from NCBI nr database GU564457.1-GAPDH N/A GU564457.1
gene parsed from NCBI nr database GU564456.1-GAPDH N/A GU564456.1
gene parsed from NCBI nr database GU564455.1-GAPDH N/A GU564455.1
gene parsed from NCBI nr database GU564454.1-GAPDH N/A GU564454.1
gene parsed from NCBI nr database GU564453.1-GAPDH N/A GU564453.1
mRNA parsed from NCBI nr database GU564458.1-GAPDH.m1 N/A GU564458.1
mRNA parsed from NCBI nr database GU564457.1-GAPDH.m1 N/A GU564457.1
mRNA parsed from NCBI nr database GU564456.1-GAPDH.m1 N/A GU564456.1
mRNA parsed from NCBI nr database GU564455.1-GAPDH.m1 N/A GU564455.1
mRNA parsed from NCBI nr database GU564454.1-GAPDH.m1 N/A GU564454.1
mRNA parsed from NCBI nr database GU564453.1-GAPDH.m1 N/A GU564453.1
gene parsed from NCBI nr database KM353281.1-GAPDH N/A KM353281.1
gene parsed from NCBI nr database KM353280.1-GAPDH N/A KM353280.1
gene parsed from NCBI nr database KM353279.1-GAPDH N/A KM353279.1
gene parsed from NCBI nr database KM353278.1-GAPDH N/A KM353278.1
gene parsed from NCBI nr database KM353277.1-GAPDH N/A KM353277.1
gene parsed from NCBI nr database KM353276.1-GAPDH N/A KM353276.1
gene parsed from NCBI nr database KM353275.1-GAPDH N/A KM353275.1
gene parsed from NCBI nr database KM353274.1-GAPDH N/A KM353274.1
gene parsed from NCBI nr database KM353273.1-GAPDH N/A KM353273.1
gene parsed from NCBI nr database KM353272.1-GAPDH N/A KM353272.1
gene parsed from NCBI nr database KM353271.1-GAPDH N/A KM353271.1
gene parsed from NCBI nr database KM353270.1-GAPDH N/A KM353270.1
gene parsed from NCBI nr database KM353269.1-GAPDH N/A KM353269.1
mRNA parsed from NCBI nr database KM353281.1-GAPDH.m1 N/A KM353281.1
mRNA parsed from NCBI nr database KM353280.1-GAPDH.m1 N/A KM353280.1
mRNA parsed from NCBI nr database KM353279.1-GAPDH.m1 N/A KM353279.1
mRNA parsed from NCBI nr database KM353278.1-GAPDH.m1 N/A KM353278.1
mRNA parsed from NCBI nr database KM353277.1-GAPDH.m1 N/A KM353277.1
mRNA parsed from NCBI nr database KM353276.1-GAPDH.m1 N/A KM353276.1
mRNA parsed from NCBI nr database KM353275.1-GAPDH.m1 N/A KM353275.1
mRNA parsed from NCBI nr database KM353274.1-GAPDH.m1 N/A KM353274.1
mRNA parsed from NCBI nr database KM353273.1-GAPDH.m1 N/A KM353273.1
mRNA parsed from NCBI nr database KM353272.1-GAPDH.m1 N/A KM353272.1
mRNA parsed from NCBI nr database KM353271.1-GAPDH.m1 N/A KM353271.1
mRNA parsed from NCBI nr database KM353270.1-GAPDH.m1 N/A KM353270.1
mRNA parsed from NCBI nr database KM353269.1-GAPDH.m1 N/A KM353269.1

Sequence(s):
>GU564458.1-GAPDH771
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcgattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagctgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaactttgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taattgtttatctttaattctgtctcaacagggaggagtttgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacaga
ataaaccatctatgctgttcggattagtgatcatcttgtggtgaatttatt
back to top
>GU564457.1-GAPDH771
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaactttgttgttaattaagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taatcgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtggcaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacaga
ataaaccatctatactgttcggattagtgatcatcttgtggtgaatttatt
back to top
>GU564456.1-GAPDH771
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagctgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaactttgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taattgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacagcaggtaaatgaatattagtcatttaatggtaggagtactacgtacaga
ataaaccatctatgctgttcggattagtgatcatcttgtggtgaatttatt
back to top
>GU564455.1-GAPDH771
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaacttcgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taattgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacaga
ataaaccatctatgctgttcggattagtgatcatcttgtggtgaatttatt
back to top
>GU564454.1-GAPDH771
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaacttcgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taattgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacaga
ataaaccatctatgctgttcggattagtgatcatcttgtggtgaatttatt
back to top
>GU564453.1-GAPDH771
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttcttgaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaactttgttgttaattaagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taatcgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtattacgtacaga
ataaaccatctatgctgttcggattagtgatcatcttgtggtgaatttagt
back to top
>GU564458.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagctgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtttgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU564457.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtggcaacag
back to top
>GU564456.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagctgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacagcag
back to top
>GU564455.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU564454.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU564453.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>KM353281.1-GAPDH749
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacagaataaaccatctatgctgttcgg
attagtgatcatcttgtggtgaatttatt
back to top
>KM353280.1-GAPDH749
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccagtgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgcaatcaaggtggggtgtcttcacattacaatgcatgtcttggttctaatcgtttatctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacagaataaaccatctatgctgtttgg
attagtgatcatcttgtggtgaatttatt
back to top
>KM353279.1-GAPDH749
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgcaatcaaggtggggtgtcttcacattacaatgcatgtcttggttctaatcgtttatctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacagaataaaccatctatgctgtttgg
attagtgatcatcttgtggtgaatttatt
back to top
>KM353278.1-GAPDH750
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccagtgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgcaatcaaggtgggggtgtcttcacattacaatgcatgtcttggttctaatcgtttatctttaattct
gtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttc
attggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacagaataaaccatctatgctgttcg
gattagtgatcatcttgtggtgaatttatt
back to top
>KM353277.1-GAPDH749
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccagtgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacagaataaaccatctatgctgttcgg
attagtgatcatcttgtggtgaatttatt
back to top
>KM353276.1-GAPDH749
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactagagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccagtgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacagaataaaccatctatgctgttcgg
attagtgatcatcttgtggtgaatttatt
back to top
>KM353275.1-GAPDH750
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactagagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccagtgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgcaatcaaggtgggggtgtcttcacattacaatgcatgtcttggttctaatcgtttatctttaattct
gtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttc
attggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacagaataaaccatctatgctgttcg
gattagtgatcatcttgtggtgaatttatt
back to top
>KM353274.1-GAPDH749
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacagaataaaccatctatgctgttcgg
attagtgatcatcttgtggtgaatttatt
back to top
>KM353273.1-GAPDH749
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaattgtttatctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacagaataaaccatctatgctgttcgg
attagtgatcatcttgtggtgaatttatt
back to top
>KM353272.1-GAPDH749
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaagtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
tggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactatgtacagaataaaccatctatgctgttcgg
attagtgatcatcttgtggtgaatttatt
back to top
>KM353271.1-GAPDH749
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgt
ctgtgtgtttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaagtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
tggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactatgtacagaataaaccatctatgctgttcgg
attagtgatcatcttgtggtgaatttatt
back to top
>KM353270.1-GAPDH749
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgt
ctgtgtgtttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaattgtttatctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacagaataaaccatctatgctgttcgg
attagtgatcatcttgtggtgaatttatt
back to top
>KM353269.1-GAPDH749
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaattgtttatctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacagaataaaccatctatgctgttcgg
attagtgatcatcttgtggtgaatttatt
back to top
>KM353281.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353280.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353279.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353278.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353277.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353276.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353275.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353274.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353273.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353272.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaagctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353271.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaagctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353270.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353269.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top