GAPDH, GAPDH (gene) Rosa foliolosa

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa foliolosa
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091043.1-GAPDHRosa foliolosagene
GAPDHDQ091042.1-GAPDHRosa foliolosagene
GAPDHDQ091041.1-GAPDHRosa foliolosagene
GAPDHDQ091040.1-GAPDHRosa foliolosagene
GAPDHEU315075.1-GAPDHRosa foliolosagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091043.1-GAPDH.m1Rosa foliolosamRNA
GAPDHDQ091042.1-GAPDH.m1Rosa foliolosamRNA
GAPDHDQ091041.1-GAPDH.m1Rosa foliolosamRNA
GAPDHDQ091040.1-GAPDH.m1Rosa foliolosamRNA
GAPDHEU315075.1-GAPDH.m1Rosa foliolosamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa foliolosagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ091043.1-GAPDH N/A DQ091043.1
gene parsed from NCBI nr database DQ091042.1-GAPDH N/A DQ091042.1
gene parsed from NCBI nr database DQ091041.1-GAPDH N/A DQ091041.1
gene parsed from NCBI nr database DQ091040.1-GAPDH N/A DQ091040.1
gene parsed from NCBI nr database EU315075.1-GAPDH N/A EU315075.1
mRNA parsed from NCBI nr database DQ091043.1-GAPDH.m1 N/A DQ091043.1
mRNA parsed from NCBI nr database DQ091042.1-GAPDH.m1 N/A DQ091042.1
mRNA parsed from NCBI nr database DQ091041.1-GAPDH.m1 N/A DQ091041.1
mRNA parsed from NCBI nr database DQ091040.1-GAPDH.m1 N/A DQ091040.1
mRNA parsed from NCBI nr database EU315075.1-GAPDH.m1 N/A EU315075.1

Sequence(s):
>DQ091043.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattttttgtg
ccactgcttcagtattgttgatacacttgttaattacatgtcggtgatacttcatctttaacagttttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtgtggtgtcatgacattacaatgcaagtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091042.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattttttgtg
ccactgcttcagtattgttgatacacttgttaattacatgtcggtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtgtggtgtcatgacattacaatgcaagtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091041.1-GAPDH754
cactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgctacagtattgttgataca
cttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgttgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatctttcatctttaattctgtctc
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattgg
tgacaacaggtaaatgaatattagtaatttaatggttggagtactacgtacagaataaaccatctatgctgtttggatta
gtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091040.1-GAPDH754
cactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattttttgtgccactgcttcagtattgttgataca
cttgttaattacatgtcggtgatacttcatctttaacagttttattaatccttgattttggaatatgtttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtgtggtgtcatgacattacaatgcaagtcttggttctaatcttttatctttaattctgtctc
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattgg
tgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggatta
gtggtcatcttgaagttgcagtggtgaatttatt
back to top
>EU315075.1-GAPDH749
gtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtat
ttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaaca
tcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgctacagtattgttgatacacttgt
aagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgttggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcact
gtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaatta
gttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatctttcatctttaattctgtctcaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgaca
acaggtaaatgaatattagtaatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtggt
catcttgaagttgcagtggtgaatttatt
back to top
>DQ091043.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091042.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091041.1-GAPDH.m1330
cactgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattc
ccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgt
gtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgc
tatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattg
gtgacaacag
back to top
>DQ091040.1-GAPDH.m1330
cactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattc
ccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgt
gtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgc
tatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattg
gtgacaacag
back to top
>EU315075.1-GAPDH.m1325
ccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgac
aacag
back to top