GAPDH, GAPDH (gene) Rosa gallica

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa gallica
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575236.1-GAPDHRosa gallicagene
GAPDHKJ575371.1-GAPDHRosa gallicagene
GAPDHKJ575370.1-GAPDHRosa gallicagene
GAPDHKJ575369.1-GAPDHRosa gallicagene
GAPDHKJ575368.1-GAPDHRosa gallicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575236.1-GAPDH.m1Rosa gallicamRNA
GAPDHKJ575371.1-GAPDH.m1Rosa gallicamRNA
GAPDHKJ575370.1-GAPDH.m1Rosa gallicamRNA
GAPDHKJ575369.1-GAPDH.m1Rosa gallicamRNA
GAPDHKJ575368.1-GAPDH.m1Rosa gallicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa gallicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575236.1-GAPDH N/A GU575236.1
mRNA parsed from NCBI nr database GU575236.1-GAPDH.m1 N/A GU575236.1
gene parsed from NCBI nr database KJ575371.1-GAPDH N/A KJ575371.1
gene parsed from NCBI nr database KJ575370.1-GAPDH N/A KJ575370.1
gene parsed from NCBI nr database KJ575369.1-GAPDH N/A KJ575369.1
gene parsed from NCBI nr database KJ575368.1-GAPDH N/A KJ575368.1
mRNA parsed from NCBI nr database KJ575371.1-GAPDH.m1 N/A KJ575371.1
mRNA parsed from NCBI nr database KJ575370.1-GAPDH.m1 N/A KJ575370.1
mRNA parsed from NCBI nr database KJ575369.1-GAPDH.m1 N/A KJ575369.1
mRNA parsed from NCBI nr database KJ575368.1-GAPDH.m1 N/A KJ575368.1

Sequence(s):
>GU575236.1-GAPDH708
catgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccag
aagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagcagcactgg
agctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatrcacttktaagttacatgtcagtgata
cttsatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggt
gtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctsaacagggaggagtctgagggaaag
ttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattag
tcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575236.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgac
aacag
back to top
>KJ575371.1-GAPDH673
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagg
tttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactg
gagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgc
cactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgat
tttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccca
ctgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaag
taaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttcta
atcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagga
tgttgtgtcaaccgacttcattggtgacaatag
back to top
>KJ575370.1-GAPDH673
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagg
tttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactg
gagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgc
cattgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgat
tttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccca
ctgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaag
taaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttcta
atcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagga
tgttgtgtcaaccgacttcattggtgacaatag
back to top
>KJ575369.1-GAPDH673
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagg
tttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagaccgttgatggaccatcagcaaaggactg
gagaggtggacgtgctgcgtcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgc
cactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgat
tttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggccttccgtgtaccca
ctgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaag
taaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttcta
atcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagga
tgttgtgtcaaccgacttcattggtgacaatag
back to top
>KJ575368.1-GAPDH673
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagg
tttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactg
gagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgc
cactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgat
tttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccca
ctgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaag
taaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttcta
atcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagga
tgttgtgtcaaccgacttcattggtgacaatag
back to top
>KJ575371.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaatag
back to top
>KJ575370.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaatag
back to top
>KJ575369.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagaccgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcgtcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgactggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaatag
back to top
>KJ575368.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaatag
back to top