GAPDH, GAPDH (gene) Rosa graciliflora

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa graciliflora
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575225.1-GAPDHRosa gracilifloragene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575225.1-GAPDH.m1Rosa gracilifloramRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa gracilifloragene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575225.1-GAPDH N/A GU575225.1
mRNA parsed from NCBI nr database GU575225.1-GAPDH.m1 N/A GU575225.1

Sequence(s):
>GU575225.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttctcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttktaagttacatgtcagtgatacttcatctktaacagctttattaatccttga
ttttggaatatstttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctsaacagggaggagtctgagggaaarttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactaygtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575225.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaarttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top