GAPDH, GAPDH (gene) Rosa gymnocarpa

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa gymnocarpa
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091047.1-GAPDHRosa gymnocarpagene
GAPDHDQ091046.1-GAPDHRosa gymnocarpagene
GAPDHDQ091045.1-GAPDHRosa gymnocarpagene
GAPDHDQ091044.1-GAPDHRosa gymnocarpagene
GAPDHEU315079.1-GAPDHRosa gymnocarpagene
GAPDHEU315078.1-GAPDHRosa gymnocarpagene
GAPDHEU315077.1-GAPDHRosa gymnocarpagene
GAPDHEU315076.1-GAPDHRosa gymnocarpagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091047.1-GAPDH.m1Rosa gymnocarpamRNA
GAPDHDQ091046.1-GAPDH.m1Rosa gymnocarpamRNA
GAPDHDQ091045.1-GAPDH.m1Rosa gymnocarpamRNA
GAPDHDQ091044.1-GAPDH.m1Rosa gymnocarpamRNA
GAPDHEU315079.1-GAPDH.m1Rosa gymnocarpamRNA
GAPDHEU315078.1-GAPDH.m1Rosa gymnocarpamRNA
GAPDHEU315077.1-GAPDH.m1Rosa gymnocarpamRNA
GAPDHEU315076.1-GAPDH.m1Rosa gymnocarpamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa gymnocarpagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ091047.1-GAPDH N/A DQ091047.1
gene parsed from NCBI nr database DQ091046.1-GAPDH N/A DQ091046.1
gene parsed from NCBI nr database DQ091045.1-GAPDH N/A DQ091045.1
gene parsed from NCBI nr database DQ091044.1-GAPDH N/A DQ091044.1
gene parsed from NCBI nr database EU315079.1-GAPDH N/A EU315079.1
gene parsed from NCBI nr database EU315078.1-GAPDH N/A EU315078.1
gene parsed from NCBI nr database EU315077.1-GAPDH N/A EU315077.1
gene parsed from NCBI nr database EU315076.1-GAPDH N/A EU315076.1
mRNA parsed from NCBI nr database DQ091047.1-GAPDH.m1 N/A DQ091047.1
mRNA parsed from NCBI nr database DQ091046.1-GAPDH.m1 N/A DQ091046.1
mRNA parsed from NCBI nr database DQ091045.1-GAPDH.m1 N/A DQ091045.1
mRNA parsed from NCBI nr database DQ091044.1-GAPDH.m1 N/A DQ091044.1
mRNA parsed from NCBI nr database EU315079.1-GAPDH.m1 N/A EU315079.1
mRNA parsed from NCBI nr database EU315078.1-GAPDH.m1 N/A EU315078.1
mRNA parsed from NCBI nr database EU315077.1-GAPDH.m1 N/A EU315077.1
mRNA parsed from NCBI nr database EU315076.1-GAPDH.m1 N/A EU315076.1

Sequence(s):
>DQ091047.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttctcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatgttctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactatgtacagaa
taaaccatctatgctgtttggattagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091046.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttctcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatgttctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctacctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgttttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactatgtacagaa
taaaccatctatgctgtttggattagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091045.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttctcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtttgtgtatttgcaattcagccacccagaagaccgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatgttctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtgttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactatgtacagaa
taaaccatctatgctgtttggattagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091044.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttctcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatgttctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactatgtacagaa
taaaccatctatgctgtttggattagtgatcatcttgaagttgcagtggtgaatttatc
back to top
>EU315079.1-GAPDH751
gtgagttctcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtat
ttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtgggcgtgctgcctcattcaaca
tcattcccagcagcactggagctgccaaggtattttcaatgttctttgtgccattgcttcagtattgttgatacactttt
aagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcact
gtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaatta
gttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgaca
acaggtaaatgaatattagtcatttaatggttggagtactatgtacagaataaaccatctatatgctgtttggattagtg
atcatcttgaagttgcagtggtgaatttatt
back to top
>EU315078.1-GAPDH749
gtgagttctcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtat
ttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaaca
tcattcccagcagcactggagctgccaaggtattttcaatgttctttgtgccactgcttcagtattgttgatacactttt
aagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggctttccgtgtacccactgttgatgtttcagttgttgacctcact
gtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaatta
gttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgaca
acaggtaaatgaatattagtcatttaatggttggagtactatgtacagaataaaccatctatgctgtttggattagtgat
catcttgaagttgcagtggtgaatttatt
back to top
>EU315077.1-GAPDH749
gtgagttctcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtat
ttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaaca
tcattcccagcagcactggagctgccaaggtattttcaatgttctttgtgccactgcttcagtattgttgatacactttt
aagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcact
gtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaatta
gttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgaca
acaggtaaatgaatattagtcatttaatggttggagtactatgtacagaataaaccatctatgctgtttggattagtgat
catcttgaagttgcagtggtgaatttatt
back to top
>EU315076.1-GAPDH749
gtgagttctcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtat
ttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaaca
tcattcccagcagcactggagctgccaaggtattttcaatgttctttgtgccactgcttcagtattgttgatacactttt
aagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcact
gtcagacttgagaagaaggccacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaatta
gttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgaca
acaggtaaatgaatattagtcatttaatggttggagtactatgtacagaataaaccatctatgctgtttggattagtgat
catcttgaagttgcagtggtgaatttatt
back to top
>DQ091047.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>DQ091046.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctacctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>DQ091045.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagaccgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>DQ091044.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>EU315079.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtgggcgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgac
aacag
back to top
>EU315078.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggctttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgac
aacag
back to top
>EU315077.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgac
aacag
back to top
>EU315076.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggccacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgac
aacag
back to top