GAPDH, GAPDH (gene) Rosa helenae

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa helenae
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575224.1-GAPDHRosa helenaegene
GAPDHKM353316.1-GAPDHRosa helenaegene
GAPDHKM353315.1-GAPDHRosa helenaegene
GAPDHKM353314.1-GAPDHRosa helenaegene
GAPDHKM353313.1-GAPDHRosa helenaegene
GAPDHKM353312.1-GAPDHRosa helenaegene
GAPDHKM353311.1-GAPDHRosa helenaegene
GAPDHKM353310.1-GAPDHRosa helenaegene
GAPDHKM353309.1-GAPDHRosa helenaegene
GAPDHKJ575378.1-GAPDHRosa helenaegene
GAPDHKJ575377.1-GAPDHRosa helenaegene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575224.1-GAPDH.m1Rosa helenaemRNA
GAPDHKM353316.1-GAPDH.m1Rosa helenaemRNA
GAPDHKM353315.1-GAPDH.m1Rosa helenaemRNA
GAPDHKM353314.1-GAPDH.m1Rosa helenaemRNA
GAPDHKM353313.1-GAPDH.m1Rosa helenaemRNA
GAPDHKM353312.1-GAPDH.m1Rosa helenaemRNA
GAPDHKM353311.1-GAPDH.m1Rosa helenaemRNA
GAPDHKM353310.1-GAPDH.m1Rosa helenaemRNA
GAPDHKM353309.1-GAPDH.m1Rosa helenaemRNA
GAPDHKJ575378.1-GAPDH.m1Rosa helenaemRNA
GAPDHKJ575377.1-GAPDH.m1Rosa helenaemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa helenaegene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575224.1-GAPDH N/A GU575224.1
mRNA parsed from NCBI nr database GU575224.1-GAPDH.m1 N/A GU575224.1
gene parsed from NCBI nr database KM353316.1-GAPDH N/A KM353316.1
gene parsed from NCBI nr database KM353315.1-GAPDH N/A KM353315.1
gene parsed from NCBI nr database KM353314.1-GAPDH N/A KM353314.1
gene parsed from NCBI nr database KM353313.1-GAPDH N/A KM353313.1
gene parsed from NCBI nr database KM353312.1-GAPDH N/A KM353312.1
gene parsed from NCBI nr database KM353311.1-GAPDH N/A KM353311.1
gene parsed from NCBI nr database KM353310.1-GAPDH N/A KM353310.1
gene parsed from NCBI nr database KM353309.1-GAPDH N/A KM353309.1
gene parsed from NCBI nr database KJ575378.1-GAPDH N/A KJ575378.1
gene parsed from NCBI nr database KJ575377.1-GAPDH N/A KJ575377.1
mRNA parsed from NCBI nr database KM353316.1-GAPDH.m1 N/A KM353316.1
mRNA parsed from NCBI nr database KM353315.1-GAPDH.m1 N/A KM353315.1
mRNA parsed from NCBI nr database KM353314.1-GAPDH.m1 N/A KM353314.1
mRNA parsed from NCBI nr database KM353313.1-GAPDH.m1 N/A KM353313.1
mRNA parsed from NCBI nr database KM353312.1-GAPDH.m1 N/A KM353312.1
mRNA parsed from NCBI nr database KM353311.1-GAPDH.m1 N/A KM353311.1
mRNA parsed from NCBI nr database KM353310.1-GAPDH.m1 N/A KM353310.1
mRNA parsed from NCBI nr database KM353309.1-GAPDH.m1 N/A KM353309.1
mRNA parsed from NCBI nr database KJ575378.1-GAPDH.m1 N/A KJ575378.1
mRNA parsed from NCBI nr database KJ575377.1-GAPDH.m1 N/A KJ575377.1

Sequence(s):
>GU575224.1-GAPDH741
gtcttatgactaccgtgcactccatcactggtaagttttcacttgtaaccatgtgagatatattaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatgcacttttaagttacatgtcagtgatacttgatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgtatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtgctacgtacagaa
taaaccatctatgctgtttgg
back to top
>GU575224.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>KM353316.1-GAPDH747
catcactggtgagttttcacttgtaaccatgtgagatacatgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
caccttcaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgccctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtgatcacatcacaattcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggat
tagtgatcatcttgtggtgaatatatt
back to top
>KM353315.1-GAPDH747
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtgatcacatcacaatgcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggat
tagtgatcatcttgtggtgaatatatt
back to top
>KM353314.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgatatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaaatctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353313.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgatatatatgaatgttaaaatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttaaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatctttaatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcattttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagccatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353312.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgatatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgcaagttacatgtcagtgatgcttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttaaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatctttaatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcattttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagccatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353311.1-GAPDH745
catcactggtgagttttcacttgtaaccatgtgagatatgaatgttaaatactagatttgaaaccaactaaagtcgtctg
tatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattca
acatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacact
tttaagttgcatgtcggtgatacttcatctgtaacagctttttattaatccttgattttggaatatctttaggctgtagg
aaaggttctgcctgctctcaatggcaagttgacgggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctg
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattgg
tgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataagccatctatgctgtttggatta
gtgatcatcttgtggtgaatttatt
back to top
>KM353310.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgatatatatgaatgttaaaatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatacttcatctgtaacagctttaataatccttgattttggaatatctttaggctgt
cgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353309.1-GAPDH789
catcactggtgagttttcacttgtaaccatgtgatatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cgggaaggttctgcctgctctcaatggcaagttgactggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttaaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtgtttggattagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KJ575378.1-GAPDH674
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgatatatatgaatgttaagatactag
attcgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
tttgggaatatctttaggctgtcgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtccgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacag
back to top
>KJ575377.1-GAPDH674
gtcttatgactaccgtgcactccatcactggtaagttttcacttgtaaccatgtgagatatattaatgttaagatactag
atttgaaaccaactaaagttgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatgcacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgtatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacag
back to top
>KM353316.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgccctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KM353315.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KM353314.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353313.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcattttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353312.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcattttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353311.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtaggaaaggttctgcctgctctcaatggcaagttgacgggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KM353310.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353309.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcgggaaggttctgcctgctctcaatggcaagttgactggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KJ575378.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcgggaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>KJ575377.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top