GAPDH, GAPDH (gene) Rosa hybrid cultivar

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa hybrid cultivar
Synonym glyceraldehyde-3-phosphate dehydrogenase
glyceraldehyde 3-phosphate dehydrogenase
RhGAPDH
Description NA
Comment GAPC
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa hybrid cultivargene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHAB370120.1-GAPDH.m1Rosa hybrid cultivarmRNA
GAPDHKT806118.1-GAPDH.m1Rosa hybrid cultivarmRNA
GAPDHKT806117.1-GAPDH.m1Rosa hybrid cultivarmRNA
GAPDHKT192570.1-GAPDH.m1Rosa hybrid cultivarmRNA
GAPDHKM353391.1-GAPDH.m1Rosa hybrid cultivarmRNA
GAPDHKM353390.1-GAPDH.m1Rosa hybrid cultivarmRNA
GAPDHKM353387.1-GAPDH.m1Rosa hybrid cultivarmRNA
GAPDHKM353386.1-GAPDH.m1Rosa hybrid cultivarmRNA
GAPDHKM353385.1-GAPDH.m1Rosa hybrid cultivarmRNA
GAPDHKM353384.1-GAPDH.m1Rosa hybrid cultivarmRNA
GAPDHKM353383.1-GAPDH.m1Rosa hybrid cultivarmRNA
GAPDHKM353364.1-GAPDH.m1Rosa hybrid cultivarmRNA
GAPDHKM353363.1-GAPDH.m1Rosa hybrid cultivarmRNA


The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHKT192570.1-GAPDHRosa hybrid cultivargene
GAPDHKM353391.1-GAPDHRosa hybrid cultivargene
GAPDHKM353390.1-GAPDHRosa hybrid cultivargene
GAPDHKM353387.1-GAPDHRosa hybrid cultivargene
GAPDHKM353386.1-GAPDHRosa hybrid cultivargene
GAPDHKM353385.1-GAPDHRosa hybrid cultivargene
GAPDHKM353384.1-GAPDHRosa hybrid cultivargene
GAPDHKM353383.1-GAPDHRosa hybrid cultivargene
GAPDHKM353364.1-GAPDHRosa hybrid cultivargene
GAPDHKM353363.1-GAPDHRosa hybrid cultivargene


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB370120.1-GAPDH.m1 N/A AB370120.1
gene parsed from NCBI nr database KT192570.1-GAPDH N/A KT192570.1
gene parsed from NCBI nr database KM353391.1-GAPDH N/A KM353391.1
gene parsed from NCBI nr database KM353390.1-GAPDH N/A KM353390.1
gene parsed from NCBI nr database KM353387.1-GAPDH N/A KM353387.1
gene parsed from NCBI nr database KM353386.1-GAPDH N/A KM353386.1
gene parsed from NCBI nr database KM353385.1-GAPDH N/A KM353385.1
gene parsed from NCBI nr database KM353384.1-GAPDH N/A KM353384.1
gene parsed from NCBI nr database KM353383.1-GAPDH N/A KM353383.1
gene parsed from NCBI nr database KM353364.1-GAPDH N/A KM353364.1
gene parsed from NCBI nr database KM353363.1-GAPDH N/A KM353363.1
mRNA parsed from NCBI nr database KT806118.1-GAPDH.m1 N/A KT806118.1
mRNA parsed from NCBI nr database KT806117.1-GAPDH.m1 N/A KT806117.1
mRNA parsed from NCBI nr database KT192570.1-GAPDH.m1 N/A KT192570.1
mRNA parsed from NCBI nr database KM353391.1-GAPDH.m1 N/A KM353391.1
mRNA parsed from NCBI nr database KM353390.1-GAPDH.m1 N/A KM353390.1
mRNA parsed from NCBI nr database KM353387.1-GAPDH.m1 N/A KM353387.1
mRNA parsed from NCBI nr database KM353386.1-GAPDH.m1 N/A KM353386.1
mRNA parsed from NCBI nr database KM353385.1-GAPDH.m1 N/A KM353385.1
mRNA parsed from NCBI nr database KM353384.1-GAPDH.m1 N/A KM353384.1
mRNA parsed from NCBI nr database KM353383.1-GAPDH.m1 N/A KM353383.1
mRNA parsed from NCBI nr database KM353364.1-GAPDH.m1 N/A KM353364.1
mRNA parsed from NCBI nr database KM353363.1-GAPDH.m1 N/A KM353363.1

Sequence(s):
>AB370120.1-GAPDH.m1683
attcatcaccaccgactacatgacctacatgtttaagtatgacaccgtccacggagcatggaagcacaatgagctcaagg
tcaaggatgagaagaccctcctcttcggtgagaagccagttgccgtcttcgggctcagaaacccagaggagatcccatgg
ggttcggttggcgccgatattgttgtggagtctactggagtgttcactgacaaggacaaagccgccgctcacttgaaggg
tggtgccaagaaggttgtcatctctgccccaagtaaggatgcccccatgtttgttgtgggagtcaatgagcatgaataca
agtccaaccttgccattgtttccaatgctagctgcactaccaactgtcttgctccccttgccaaggttatcaacgacagg
tttggaattgttgagggtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaa
ggactggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttc
tgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtc
agacttgagaagaaggcaacctatgaccagatcaaggctgcta
back to top
>KT192570.1-GAPDH454
tctactggtgtcttcactgacaaggacaaagccgcgactcacttgaaggttaaccctcttacaagtttcctttaaaaata
tatcggtttgattagtcccactattttggtgtatatataaaactgacagtttcgaggaattagtatttggttgttgttgc
aacggttttgatgtttgatggagttttttcatttgagtaatggttaagcacctgcttcgttgttaagtttccctagtact
gttatttgcttacatgacagtgaagacgtgcatccatcttacgtctttgatagtcatttggatagttctatatctacttt
gatggtcattctggatttaacttgtactctttgttctggatttaacttgtactgtttgtgcgaccagggtggtgccaaaa
aggttgtcatttctgccccaagtaaggatgcccccatgtttgttgtgggtgtca
back to top
>KM353391.1-GAPDH789
catcactggtgagttttcacttgtaaccacgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcccc
attcaacatcattcccagcagcaccggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggactatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattatgt
ctcaacagggaggagtctgagggaaagttgaaaggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaattgtcatttaatggtaggagtactacgtacagaataaaccatctatgctgtttggatta
gtgatcatcttgtggtggattagtgatcatcttgtggtggattagtgatcatcttgtggtgaatttatt
back to top
>KM353390.1-GAPDH745
catcactggtgagttttcacttgtaaccatgtgagatatgaatgttaaatactagatttgaaaccaactaaagtcgtctg
tatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattca
acatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacact
tttaagttgcatgtcggtgatacttcatctgtaacagctttttattaatccttgattttggaatatctttaggctgtagg
aaaggttctgcctgctctcaatggcaagttgacgggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctg
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattgg
tgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataagccatctatgctgtttggatta
gtgatcatcttgtggtgaatttatt
back to top
>KM353387.1-GAPDH646
catcactggtgagttttctcttgtaaccatgtgagatatgaatgttaaatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtgggcgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgactggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctg
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattgg
tgacaa
back to top
>KM353386.1-GAPDH645
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaatttagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgactggaatggcattccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtcatcacatcacaatgcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtga
back to top
>KM353385.1-GAPDH648
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaatttagccacccagaagactgttgatggaccatcagcaaaggactggagaggtgggcgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgactggaatggcattccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtcatcacatcacaatgcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaa
back to top
>KM353384.1-GAPDH648
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaatttagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgactggaatggcattccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtcatcacatcacaatgcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaa
back to top
>KM353383.1-GAPDH648
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaatttagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagccgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttttaagttacaagtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgactggaatggccttccgtgtatccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaa
back to top
>KM353364.1-GAPDH734
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacagaataaaccatctatgatcatctt
gtggtgaatttatt
back to top
>KM353363.1-GAPDH747
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtcatcacatcacaatgcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggat
tagtgatcatcttgtggtgaatatatt
back to top
>KT806118.1-GAPDH.m1160
cagtgagacttgagaagaaggctacttatgatgagattaaaaatgctatcaaggaagaatctgagggtaacctaaaggga
atcctcggatatatggacgatgatttagtgtccactgactttgtggataaccacaggtcaagcatctttgatgccaaggc
back to top
>KT806117.1-GAPDH.m1537
agggtggtgccaaaaaggttgtcatttctgccccaagtaaggatgctcccatgtttgttgtgggtgtcaatgagaaggaa
tacaagtcagaccttaccattgtgtctaatgccagctgcacgaccaactgtcttgctccccttgccaaggttatcaatga
tagattcggaattgttgagggccttatgaccactgttcactccatcacagccacacagaaaactgttgatggcccatcaa
gtaaggactggagaggcggacgtgctgcttcattcaacatcattcctagcagcactggagctgccaaggctgttggaaaa
gttctaccagctctcaatggcaaattgactggaatggccttccgtgttcccactgttgatgtttcagtcgttgacctcac
tgtcaggcttgagaagaaggccacatatgaccagattaaggctgctatcaaggaggagtccgagggaaagctcaagggta
tcttgggttacaccgaagacgatgttgtgtcaactgacttcatcggtgacaacaggt
back to top
>KT192570.1-GAPDH.m1115
tctactggtgtcttcactgacaaggacaaagccgcgactcacttgaagggtggtgccaaaaaggttgtcatttctgcccc
aagtaaggatgcccccatgtttgttgtgggtgtca
back to top
>KM353391.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgccccattcaacatca
ttcccagcagcaccggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaaaggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353390.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtaggaaaggttctgcctgctctcaatggcaagttgacgggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KM353387.1-GAPDH.m1330
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgggcgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaa
back to top
>KM353386.1-GAPDH.m1327
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggcattc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtga
back to top
>KM353385.1-GAPDH.m1330
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgggcgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggcattc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaa
back to top
>KM353384.1-GAPDH.m1330
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggcattc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaa
back to top
>KM353383.1-GAPDH.m1330
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagccgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggccttc
cgtgtatccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaa
back to top
>KM353364.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353363.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top