GAPDH, GAPDH (gene) Rosa laevigata

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa laevigata
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575222.1-GAPDHRosa laevigatagene
GAPDHKM353348.1-GAPDHRosa laevigatagene
GAPDHKM353347.1-GAPDHRosa laevigatagene
GAPDHKJ575382.1-GAPDHRosa laevigatagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575222.1-GAPDH.m1Rosa laevigatamRNA
GAPDHKM353348.1-GAPDH.m1Rosa laevigatamRNA
GAPDHKM353347.1-GAPDH.m1Rosa laevigatamRNA
GAPDHKJ575382.1-GAPDH.m1Rosa laevigatamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa laevigatagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575222.1-GAPDH N/A GU575222.1
mRNA parsed from NCBI nr database GU575222.1-GAPDH.m1 N/A GU575222.1
gene parsed from NCBI nr database KM353348.1-GAPDH N/A KM353348.1
gene parsed from NCBI nr database KM353347.1-GAPDH N/A KM353347.1
gene parsed from NCBI nr database KJ575382.1-GAPDH N/A KJ575382.1
mRNA parsed from NCBI nr database KM353348.1-GAPDH.m1 N/A KM353348.1
mRNA parsed from NCBI nr database KM353347.1-GAPDH.m1 N/A KM353347.1
mRNA parsed from NCBI nr database KJ575382.1-GAPDH.m1 N/A KJ575382.1

Sequence(s):
>GU575222.1-GAPDH762
gtcttatgactactgtgcactccatcactggtgagttttcacttgtgaccatgtgagatatatgaatgttaatcatttgc
atgttttgaaaccaactgaagttgtctgtgtrtttgtaattcagccacccagaagactgttgatggaccatcagccaagg
actggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattcttt
atgtgactgcttcagtattgttgatacatttttaagttaygtgtcaaatgatacttcatctttaacagctttattaatcc
ttgattttggaatgtgtttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgt
acccactgttgatgtttcagttgttgacctcactgtcaggcttgagaaggcggcaacctatgaccagatcaaggctgcta
tcaagtaaggcttgttgaactttgttgttaatcagttgcaatcaaggtggggtgtcatgacatkacaatgcatgtgttgg
ttttaatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgat
gaggatgttgtgtcaaccgacttcattggtgacagcaggtaaatgaatattagtcattcaatggttggagtactatgtac
agaataaaccatctaatcctgtttggattagtgatcatcttg
back to top
>GU575222.1-GAPDH.m1355
gtcttatgactactgtgcactccatcactgccacccagaagactgttgatggaccatcagccaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcaggcttgagaaggcgg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacagcag
back to top
>KM353348.1-GAPDH762
catcactggtgagttttcacttgtgaccatgtgagatatatgaatgttaatcatttgcatgttttgaaaccaactgaagt
tgtctgtgtgtttgtaattcagccacccagaagactgttgatggaccatcagccaaggactggagaggtggacgtgctgc
ctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttatgtgactgcttcagtattgtt
gatacatttttaagttacgtgtcaaatgatacttcatctttaacagctttattaatccttgattttggaatgtgtttagg
ctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagtt
gttgacctcactgtcaggcttgagaaggcggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactt
tgttgttaatcagttgcaatcaaggtggggtgtcatgacattacaatgcatgtgttggttttaatcttttatctttaatt
ctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacactgatgaggatgttgtgtcaaccgact
tcattggtgacagcaggtaaatgaatattagtcattcaatggttggagtactatgtacagaataaaccatctaatcctgt
ttggattagtgatcatcttgaagttgcagtgttgaatttatt
back to top
>KM353347.1-GAPDH762
catcactggtgagttttcacttgtgaccatgtgagatatatgaatgttaatcatttgcatgttttgaaaccaactgaagt
tgtctgtgtgtttgtaattcagccacccagaagactgttgatggaccatcagccaaggactggagaggtggacgtgctgc
ctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttatgtgactgcttcagtattgtt
gatacatttttaagttacgtgtcaaatgatacttcatctttaacagctttattaatccttgattttggaatgtgtttagg
ctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagtt
gttgacctcactgtcaggcttgagaaggcggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactt
tgttgttaatcagttgcaatcaaggtggggtgtcatgacattacaatgcatgtgttggttttaatcttttatctttaatt
ctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgact
tcattggtgacagcaggtaaatgaatattagtcattcaatggttggagtactatgtacagaataaaccatctaatcctgt
ttggattagtgatcatcttgaagttgcagtgttgaatttatt
back to top
>KJ575382.1-GAPDH678
gtcttatgactactgtgcactccatcactggtgagttttcacttgtgaccatgtgagatatatgaatgttaatcatttgc
atgttttgaaaccaactgaagttgtctgtgtgtttgtaattcagccacccagaagactgttgatggaccatcagccaagg
actggagaggtggacgkgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattcttt
atgtgactgcttcagtattgttgatacatttttaagttacgtgtcaaatgatacttcatctttaacagctttattaatcc
ttgattttggaatgtgtttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgt
acccactgttgatgtttcagttgttgacctcactgtcaggcttgagaaggcggcaacctatgaccagatcaaggctgcta
tcaagtaaggcttgttgaactttgttgttaatcagttgcaatcaaggtggggtgtcatgacattacaatgcatgtgttgg
ttttaatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgat
gaggatgttgtgtcaaccgacttcattggtgacagcag
back to top
>KM353348.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagccaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcaggcttgagaaggcggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacactgatgaggatgttgtgtcaaccgacttca
ttggtgacagcag
back to top
>KM353347.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagccaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcaggcttgagaaggcggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacagcag
back to top
>KJ575382.1-GAPDH.m1355
gtcttatgactactgtgcactccatcactgccacccagaagactgttgatggaccatcagccaaggactggagaggtgga
cgkgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcaggcttgagaaggcgg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacagcag
back to top