GAPDH, GAPDH (gene) Rosa longicuspis

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa longicuspis
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575219.1-GAPDHRosa longicuspisgene
GAPDHGU575218.1-GAPDHRosa longicuspisgene
GAPDHKM353356.1-GAPDHRosa longicuspisgene
GAPDHKM353355.1-GAPDHRosa longicuspisgene
GAPDHKM353354.1-GAPDHRosa longicuspisgene
GAPDHKM353353.1-GAPDHRosa longicuspisgene
GAPDHKM353352.1-GAPDHRosa longicuspisgene
GAPDHKJ575388.1-GAPDHRosa longicuspisgene
GAPDHKJ575387.1-GAPDHRosa longicuspisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575219.1-GAPDH.m1Rosa longicuspismRNA
GAPDHGU575218.1-GAPDH.m1Rosa longicuspismRNA
GAPDHKM353356.1-GAPDH.m1Rosa longicuspismRNA
GAPDHKM353355.1-GAPDH.m1Rosa longicuspismRNA
GAPDHKM353354.1-GAPDH.m1Rosa longicuspismRNA
GAPDHKM353353.1-GAPDH.m1Rosa longicuspismRNA
GAPDHKM353352.1-GAPDH.m1Rosa longicuspismRNA
GAPDHKJ575388.1-GAPDH.m1Rosa longicuspismRNA
GAPDHKJ575387.1-GAPDH.m1Rosa longicuspismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa longicuspisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575219.1-GAPDH N/A GU575219.1
gene parsed from NCBI nr database GU575218.1-GAPDH N/A GU575218.1
mRNA parsed from NCBI nr database GU575219.1-GAPDH.m1 N/A GU575219.1
mRNA parsed from NCBI nr database GU575218.1-GAPDH.m1 N/A GU575218.1
gene parsed from NCBI nr database KM353356.1-GAPDH N/A KM353356.1
gene parsed from NCBI nr database KM353355.1-GAPDH N/A KM353355.1
gene parsed from NCBI nr database KM353354.1-GAPDH N/A KM353354.1
gene parsed from NCBI nr database KM353353.1-GAPDH N/A KM353353.1
gene parsed from NCBI nr database KM353352.1-GAPDH N/A KM353352.1
gene parsed from NCBI nr database KJ575388.1-GAPDH N/A KJ575388.1
gene parsed from NCBI nr database KJ575387.1-GAPDH N/A KJ575387.1
mRNA parsed from NCBI nr database KM353356.1-GAPDH.m1 N/A KM353356.1
mRNA parsed from NCBI nr database KM353355.1-GAPDH.m1 N/A KM353355.1
mRNA parsed from NCBI nr database KM353354.1-GAPDH.m1 N/A KM353354.1
mRNA parsed from NCBI nr database KM353353.1-GAPDH.m1 N/A KM353353.1
mRNA parsed from NCBI nr database KM353352.1-GAPDH.m1 N/A KM353352.1
mRNA parsed from NCBI nr database KJ575388.1-GAPDH.m1 N/A KJ575388.1
mRNA parsed from NCBI nr database KJ575387.1-GAPDH.m1 N/A KJ575387.1

Sequence(s):
>GU575219.1-GAPDH723
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgatatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttrcatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taa
back to top
>GU575218.1-GAPDH759
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatactttatctgtaacagctttattaatccctga
ttttggaatatcttcaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtacactacgtacag
aataaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575219.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcgggaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575218.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>KM353356.1-GAPDH759
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgcaagttacatgtcagtgatactttatctgtaacagctttattaatccctgattttggaatatcttcaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtacactacgtacagaataaaccatctatgctgtttg
gattagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353355.1-GAPDH759
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatactttatctgtaacagctttattaatccctgattttggaatatcttcaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtacactacgtacagaataaaccatctatgctgtttg
gattagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353354.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgaaatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatacttcatctgtaacagcttttttaatccctgattttggaatatcttcaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353353.1-GAPDH759
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatactttatctgtaacagctttattaatccctgattttggaatatcttcaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtacactacgtacagaataaaccatctatgctgtttg
gattagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353352.1-GAPDH759
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtatcttcaatattctttgtgccactgcttcagtattgtcgat
acacttgtaagttacatgtcagtgatactttatctgtaacagctttattaatccctgattttggaatatcttcaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttg
acctcactgccagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtacactacgtacagaataaaccatctatgctgtttg
cattagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KJ575388.1-GAPDH674
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgatatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcgggaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacag
back to top
>KJ575387.1-GAPDH674
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttggtacacttgtaagttacatgtcagtgatactttatctgtaacagctttattaatccctga
ttttggaatatcttcaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacag
back to top
>KM353356.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353355.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353354.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353353.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353352.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgcgtacccactgttgatgtttcagttgttgacctcactgccagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KJ575388.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcgggaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>KJ575387.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top