GAPDH, GAPDH (gene) Rosa multiflora

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa multiflora
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091173.1-GAPDHRosa multifloragene
GAPDHDQ091172.1-GAPDHRosa multifloragene
GAPDHKM353389.1-GAPDHRosa multifloragene
GAPDHKM353388.1-GAPDHRosa multifloragene
GAPDHKM353382.1-GAPDHRosa multifloragene
GAPDHKM353381.1-GAPDHRosa multifloragene
GAPDHKM353380.1-GAPDHRosa multifloragene
GAPDHKM353379.1-GAPDHRosa multifloragene
GAPDHKM353378.1-GAPDHRosa multifloragene
GAPDHKJ575396.1-GAPDHRosa multifloragene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091173.1-GAPDH.m1Rosa multifloramRNA
GAPDHDQ091172.1-GAPDH.m1Rosa multifloramRNA
GAPDHKM353389.1-GAPDH.m1Rosa multifloramRNA
GAPDHKM353388.1-GAPDH.m1Rosa multifloramRNA
GAPDHKM353382.1-GAPDH.m1Rosa multifloramRNA
GAPDHKM353381.1-GAPDH.m1Rosa multifloramRNA
GAPDHKM353380.1-GAPDH.m1Rosa multifloramRNA
GAPDHKM353379.1-GAPDH.m1Rosa multifloramRNA
GAPDHKM353378.1-GAPDH.m1Rosa multifloramRNA
GAPDHKJ575396.1-GAPDH.m1Rosa multifloramRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa multifloragene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ091173.1-GAPDH N/A DQ091173.1
gene parsed from NCBI nr database DQ091172.1-GAPDH N/A DQ091172.1
mRNA parsed from NCBI nr database DQ091173.1-GAPDH.m1 N/A DQ091173.1
mRNA parsed from NCBI nr database DQ091172.1-GAPDH.m1 N/A DQ091172.1
gene parsed from NCBI nr database KM353389.1-GAPDH N/A KM353389.1
gene parsed from NCBI nr database KM353388.1-GAPDH N/A KM353388.1
gene parsed from NCBI nr database KM353382.1-GAPDH N/A KM353382.1
gene parsed from NCBI nr database KM353381.1-GAPDH N/A KM353381.1
gene parsed from NCBI nr database KM353380.1-GAPDH N/A KM353380.1
gene parsed from NCBI nr database KM353379.1-GAPDH N/A KM353379.1
gene parsed from NCBI nr database KM353378.1-GAPDH N/A KM353378.1
gene parsed from NCBI nr database KJ575396.1-GAPDH N/A KJ575396.1
mRNA parsed from NCBI nr database KM353389.1-GAPDH.m1 N/A KM353389.1
mRNA parsed from NCBI nr database KM353388.1-GAPDH.m1 N/A KM353388.1
mRNA parsed from NCBI nr database KM353382.1-GAPDH.m1 N/A KM353382.1
mRNA parsed from NCBI nr database KM353381.1-GAPDH.m1 N/A KM353381.1
mRNA parsed from NCBI nr database KM353380.1-GAPDH.m1 N/A KM353380.1
mRNA parsed from NCBI nr database KM353379.1-GAPDH.m1 N/A KM353379.1
mRNA parsed from NCBI nr database KM353378.1-GAPDH.m1 N/A KM353378.1
mRNA parsed from NCBI nr database KJ575396.1-GAPDH.m1 N/A KJ575396.1

Sequence(s):
>DQ091173.1-GAPDH767
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatgaatgttaaatactagatt
tgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactgga
gaggtgggcgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgcca
ctgcttcagtattgttgatacacttttaagttgcatgtcggtgatacttcatctgtaacagctttattaatccttgattt
tggaatgtctttaggctgtaggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccact
gttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagta
aggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaat
cttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatg
ttgtgtcaaccgacttcattggtgacaataggtaaatgaatattagtcacttaatggttggagtactacgtacagaataa
gccatctatgctgtttggattagtgatcatcttgtggtgaatttatt
back to top
>DQ091172.1-GAPDH767
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatgaatgttaaatactagatt
tgaaaccaactaaagtcgtctgtgtgtttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactgga
gaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgcca
ctgcttcagtattgttgatacacttttaagttgcatgtcagtgatacttcatctgtaacagctttattaatccttgattt
tggaatatctttaggctgtaggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccact
gttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagta
aggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaat
cttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatg
ttgtgtcaactgacttcattggtgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataa
gccatctatgctgtttggattagtgatcatcttgtggtgaatttatt
back to top
>DQ091173.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggg
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtaggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaatag
back to top
>DQ091172.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtaggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaatag
back to top
>KM353389.1-GAPDH745
catcactggtgagttttctcttgtaaccatgtgagatatgaatgttaaatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtgggcgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgactggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctg
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattgg
tgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataagccatctatgctgtttggatta
gtgatcatcttgtggtgaatttatt
back to top
>KM353388.1-GAPDH803
catcaccggtgagttttcacttgtaaccatgtgagatatggatgttaaatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtagtttcaatattctttttgccactgcttcagtattgctgataca
cttttaagttacatgtcagtgatacttcatctgtaacagcttcagtattgttgatacacttgtaagttacgtgtcagtga
tacttcatctgtaacagctttattaatccttgattttggaatatctgtaggctgtcggaaaggttctgcctgctctcaat
ggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaa
ggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggg
gtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacagggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaataggtaaatgaatatt
agtcatttaatggttggagtactacgtacagaataagccatctatgctgtttggattagtgatcatcttgtggtgaattt
att
back to top
>KM353382.1-GAPDH745
catcactggtgagttttcacttgtaaccatgtgagatatgaatgttaaatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccgtcagcaaaggactggagaggtgggcgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttgtaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatgtctttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggctggttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctg
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattgg
tgacaataggtaaatgaatattagtcacttaatggttggagtactacgtacagaataagccatctatgctgtttggatta
gtgatcatcttgtggtgaatttatt
back to top
>KM353381.1-GAPDH747
catcacaggtgagttttcactggtaaccatgtgagatatgaatgtttaattctagatttgaaaccaactaaaagtcgtct
gtgtatttgcaattcagccacccagaagactgtttgatggaccgtcagcaaaggactggagaggtgggcgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttgtaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatgtctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggctggttgaactttgttg
ttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcatt
ggtgacaataggtaaatgaatattagtcacttaatggttggagtactacgtacagaataagccatctatgctgtttggat
tagtgatcatcttgtggtgaatttatt
back to top
>KM353380.1-GAPDH745
catcactggtgagttttctcttgtaaccatgtgagatatgaatgttaaatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtgggcgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgactggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctg
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattgg
tgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataagccatctatgctgtttggatta
gtgatcatcttgtggtgaatttatt
back to top
>KM353379.1-GAPDH745
catcactggtgagttttcacttgtaaccatgtgagatatgaatgttaaatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtgggcgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgactggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctg
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattgg
tgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataagccatctatgctgtttggatta
gtgatcatcttgtggtgaatttatt
back to top
>KM353378.1-GAPDH746
catcactggtgagttttcacttgtaaccatgtgagatatgaatgttaaatactagatttgaaaccaactaaagtcgtctg
tgtattttgcaattcagccacccagaagactgttgatggaccgtcagcaaaggactggagaggtgggcgtgctgcctcat
tcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatac
tcttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatgtctttaggctgtcg
gaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgac
ctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgt
taattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtct
gaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattg
gtgacaataggtaaatgaatattagtcacttaatggttggagtactacgtacagaataagccatctatgctgtttggatt
agtgatcatcttgtggtgaatttatt
back to top
>KJ575396.1-GAPDH787
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatggatgttaaatactagatt
tgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactgga
gaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtagtttcaatattctttgtgcca
ctgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagcttcagtattgttgataca
cttgtaagttacgtgtcagtgatacttcatctgtaacagcttcagtattgttgatacacttgtaagttacgtgtcagtga
tacttcatctgtaacagctttattaatccttgattttggaatatctgtaggctgtcggaaaggttctgcctgctctcaat
ggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaa
ggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggg
gtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacagggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacwatag
back to top
>KM353389.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgggcgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KM353388.1-GAPDH.m1333
catcaccgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KM353382.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccgtcagcaaaggactggagaggtgggcgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttca
ttggtgacaatag
back to top
>KM353381.1-GAPDH.m1334
catcacagccacccagaagactgtttgatggaccgtcagcaaaggactggagaggtgggcgtgctgcctcattcaacatc
attcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggcctt
ccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaagg
ctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttc
attggtgacaatag
back to top
>KM353380.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgggcgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KM353379.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgggcgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KM353378.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccgtcagcaaaggactggagaggtgggcgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KJ575396.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacwatag
back to top