GAPDH, GAPDH (gene) Rosa nitida

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa nitida
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091055.1-GAPDHRosa nitidagene
GAPDHDQ091054.1-GAPDHRosa nitidagene
GAPDHDQ091053.1-GAPDHRosa nitidagene
GAPDHDQ091052.1-GAPDHRosa nitidagene
GAPDHDQ091051.1-GAPDHRosa nitidagene
GAPDHDQ091050.1-GAPDHRosa nitidagene
GAPDHDQ091049.1-GAPDHRosa nitidagene
GAPDHDQ091048.1-GAPDHRosa nitidagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091055.1-GAPDH.m1Rosa nitidamRNA
GAPDHDQ091054.1-GAPDH.m1Rosa nitidamRNA
GAPDHDQ091053.1-GAPDH.m1Rosa nitidamRNA
GAPDHDQ091052.1-GAPDH.m1Rosa nitidamRNA
GAPDHDQ091051.1-GAPDH.m1Rosa nitidamRNA
GAPDHDQ091050.1-GAPDH.m1Rosa nitidamRNA
GAPDHDQ091049.1-GAPDH.m1Rosa nitidamRNA
GAPDHDQ091048.1-GAPDH.m1Rosa nitidamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa nitidagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ091055.1-GAPDH N/A DQ091055.1
gene parsed from NCBI nr database DQ091054.1-GAPDH N/A DQ091054.1
gene parsed from NCBI nr database DQ091053.1-GAPDH N/A DQ091053.1
gene parsed from NCBI nr database DQ091052.1-GAPDH N/A DQ091052.1
gene parsed from NCBI nr database DQ091051.1-GAPDH N/A DQ091051.1
gene parsed from NCBI nr database DQ091050.1-GAPDH N/A DQ091050.1
gene parsed from NCBI nr database DQ091049.1-GAPDH N/A DQ091049.1
gene parsed from NCBI nr database DQ091048.1-GAPDH N/A DQ091048.1
mRNA parsed from NCBI nr database DQ091055.1-GAPDH.m1 N/A DQ091055.1
mRNA parsed from NCBI nr database DQ091054.1-GAPDH.m1 N/A DQ091054.1
mRNA parsed from NCBI nr database DQ091053.1-GAPDH.m1 N/A DQ091053.1
mRNA parsed from NCBI nr database DQ091052.1-GAPDH.m1 N/A DQ091052.1
mRNA parsed from NCBI nr database DQ091051.1-GAPDH.m1 N/A DQ091051.1
mRNA parsed from NCBI nr database DQ091050.1-GAPDH.m1 N/A DQ091050.1
mRNA parsed from NCBI nr database DQ091049.1-GAPDH.m1 N/A DQ091049.1
mRNA parsed from NCBI nr database DQ091048.1-GAPDH.m1 N/A DQ091048.1

Sequence(s):
>DQ091055.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagcggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091054.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgcaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091053.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagcggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091052.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgcaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091051.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagcggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091050.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtatgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaacttcgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091049.1-GAPDH751
tggtgagttttcacttgcaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091048.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgactggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgacgttgcagtggtgaatttatt
back to top
>DQ091055.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091054.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091053.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091052.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091051.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091050.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091049.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091048.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top