GAPDH, GAPDH (gene) Rosa odorata var. erubescens

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa odorata var. erubescens
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575195.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575194.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575193.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575192.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575191.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575190.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575189.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575188.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575187.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575186.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575185.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575184.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575183.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575182.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575181.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575180.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575179.1-GAPDHRosa odorata var. erubescensgene
GAPDHGU575178.1-GAPDHRosa odorata var. erubescensgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575195.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575194.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575193.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575192.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575191.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575190.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575189.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575188.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575187.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575186.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575185.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575184.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575183.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575182.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575181.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575180.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575179.1-GAPDH.m1Rosa odorata var. erubescensmRNA
GAPDHGU575178.1-GAPDH.m1Rosa odorata var. erubescensmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa odorata var. erubescensgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575195.1-GAPDH N/A GU575195.1
gene parsed from NCBI nr database GU575194.1-GAPDH N/A GU575194.1
gene parsed from NCBI nr database GU575193.1-GAPDH N/A GU575193.1
gene parsed from NCBI nr database GU575192.1-GAPDH N/A GU575192.1
gene parsed from NCBI nr database GU575191.1-GAPDH N/A GU575191.1
gene parsed from NCBI nr database GU575190.1-GAPDH N/A GU575190.1
gene parsed from NCBI nr database GU575189.1-GAPDH N/A GU575189.1
gene parsed from NCBI nr database GU575188.1-GAPDH N/A GU575188.1
gene parsed from NCBI nr database GU575187.1-GAPDH N/A GU575187.1
gene parsed from NCBI nr database GU575186.1-GAPDH N/A GU575186.1
gene parsed from NCBI nr database GU575185.1-GAPDH N/A GU575185.1
gene parsed from NCBI nr database GU575184.1-GAPDH N/A GU575184.1
gene parsed from NCBI nr database GU575183.1-GAPDH N/A GU575183.1
gene parsed from NCBI nr database GU575182.1-GAPDH N/A GU575182.1
gene parsed from NCBI nr database GU575181.1-GAPDH N/A GU575181.1
gene parsed from NCBI nr database GU575180.1-GAPDH N/A GU575180.1
gene parsed from NCBI nr database GU575179.1-GAPDH N/A GU575179.1
gene parsed from NCBI nr database GU575178.1-GAPDH N/A GU575178.1
mRNA parsed from NCBI nr database GU575195.1-GAPDH.m1 N/A GU575195.1
mRNA parsed from NCBI nr database GU575194.1-GAPDH.m1 N/A GU575194.1
mRNA parsed from NCBI nr database GU575193.1-GAPDH.m1 N/A GU575193.1
mRNA parsed from NCBI nr database GU575192.1-GAPDH.m1 N/A GU575192.1
mRNA parsed from NCBI nr database GU575191.1-GAPDH.m1 N/A GU575191.1
mRNA parsed from NCBI nr database GU575190.1-GAPDH.m1 N/A GU575190.1
mRNA parsed from NCBI nr database GU575189.1-GAPDH.m1 N/A GU575189.1
mRNA parsed from NCBI nr database GU575188.1-GAPDH.m1 N/A GU575188.1
mRNA parsed from NCBI nr database GU575187.1-GAPDH.m1 N/A GU575187.1
mRNA parsed from NCBI nr database GU575186.1-GAPDH.m1 N/A GU575186.1
mRNA parsed from NCBI nr database GU575185.1-GAPDH.m1 N/A GU575185.1
mRNA parsed from NCBI nr database GU575184.1-GAPDH.m1 N/A GU575184.1
mRNA parsed from NCBI nr database GU575183.1-GAPDH.m1 N/A GU575183.1
mRNA parsed from NCBI nr database GU575182.1-GAPDH.m1 N/A GU575182.1
mRNA parsed from NCBI nr database GU575181.1-GAPDH.m1 N/A GU575181.1
mRNA parsed from NCBI nr database GU575180.1-GAPDH.m1 N/A GU575180.1
mRNA parsed from NCBI nr database GU575179.1-GAPDH.m1 N/A GU575179.1
mRNA parsed from NCBI nr database GU575178.1-GAPDH.m1 N/A GU575178.1

Sequence(s):
>GU575195.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575194.1-GAPDH821
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactatgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaa
agtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgc
tgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtatt
gttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattcttgaatatcttta
ggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcag
ttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaac
tttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaa
ttctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccga
cttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctg
tttggattagtgatcatcttg
back to top
>GU575193.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575192.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacactcttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575191.1-GAPDH433
gaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgt
tgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaag
gcttgttgaactttgttgttaattaagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatc
gtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgt
tgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtattacgtacagaataaa
ccatctatgctgttcggattagtgatcatcttg
back to top
>GU575190.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575189.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacatgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575188.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575187.1-GAPDH818
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactatgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaa
agtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgc
tgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtatt
gttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattcttgaatatcttta
ggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcag
ttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaac
tttgttgttaattaagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatcttta
attctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccg
acttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtattacgtacagaataaaccatctatgct
gttcggattagtgatcat
back to top
>GU575186.1-GAPDH822
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactatgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaa
agtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgc
tgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtatt
gttgacacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattcttgaatatcttta
ggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcag
ttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaac
tttgttgttaattaagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatcttta
attctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccg
acttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtattacgtacagaataaaccatctatgct
gttcggattagtgatcatcttg
back to top
>GU575185.1-GAPDH716
cttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtatttgcaattcag
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggtattttcaatattctttgggccactgcttcagtattgttgatacacttttaagttacatgt
cagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgttggaaaggttctgcctgct
ctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttga
gaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaa
ggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacagggaggagtctg
agggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacaggtaaatg
aatattagtcatttaatggttggagtactacgcacagaataaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575184.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575183.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575182.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575181.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575180.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
tcactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgctgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575179.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgcagcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgctgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575178.1-GAPDH739
actccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaag
tcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctg
cctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgggccactgcttcagtattgt
tgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttagg
ctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagtt
gttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactt
tgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaatt
ctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgact
tcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtt
tggattagtgatcatcttg
back to top
>GU575195.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575194.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575193.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575192.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575191.1-GAPDH.m1227
gctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575190.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575189.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575188.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575187.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575186.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575185.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgac
aacag
back to top
>GU575184.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575183.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575182.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575181.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575180.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575179.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgcagcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgctgtgtcaaccgacttcattggtgacaacag
back to top
>GU575178.1-GAPDH.m1337
actccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaac
atcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggc
cttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatca
aggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgac
ttcattggtgacaacag
back to top