GAPDH, GAPDH (gene) Rosa odorata var. gigantea

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa odorata var. gigantea
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHKF562857.1-GAPDHRosa odorata var. giganteagene
GAPDHKF562856.1-GAPDHRosa odorata var. giganteagene
GAPDHKF562855.1-GAPDHRosa odorata var. giganteagene
GAPDHKF562854.1-GAPDHRosa odorata var. giganteagene
GAPDHKF562853.1-GAPDHRosa odorata var. giganteagene
GAPDHKF562852.1-GAPDHRosa odorata var. giganteagene
GAPDHKF562851.1-GAPDHRosa odorata var. giganteagene
GAPDHKF562850.1-GAPDHRosa odorata var. giganteagene
GAPDHKF562849.1-GAPDHRosa odorata var. giganteagene
GAPDHKF562848.1-GAPDHRosa odorata var. giganteagene
GAPDHKF562847.1-GAPDHRosa odorata var. giganteagene
GAPDHKF562846.1-GAPDHRosa odorata var. giganteagene
GAPDHKF562845.1-GAPDHRosa odorata var. giganteagene
GAPDHKF562844.1-GAPDHRosa odorata var. giganteagene
GAPDHGU575208.1-GAPDHRosa odorata var. giganteagene
GAPDHGU575207.1-GAPDHRosa odorata var. giganteagene
GAPDHGU575206.1-GAPDHRosa odorata var. giganteagene
GAPDHGU575205.1-GAPDHRosa odorata var. giganteagene
GAPDHGU575204.1-GAPDHRosa odorata var. giganteagene
GAPDHKM353303.1-GAPDHRosa odorata var. giganteagene
GAPDHKM353302.1-GAPDHRosa odorata var. giganteagene
GAPDHKM353301.1-GAPDHRosa odorata var. giganteagene
GAPDHKM353300.1-GAPDHRosa odorata var. giganteagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHKF562857.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKF562856.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKF562855.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKF562854.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKF562853.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKF562852.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKF562851.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKF562850.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKF562849.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKF562848.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKF562847.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKF562846.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKF562845.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKF562844.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHGU575208.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHGU575207.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHGU575206.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHGU575205.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHGU575204.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKM353303.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKM353302.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKM353301.1-GAPDH.m1Rosa odorata var. giganteamRNA
GAPDHKM353300.1-GAPDH.m1Rosa odorata var. giganteamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa odorata var. giganteagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database KF562857.1-GAPDH N/A KF562857.1
gene parsed from NCBI nr database KF562856.1-GAPDH N/A KF562856.1
gene parsed from NCBI nr database KF562855.1-GAPDH N/A KF562855.1
gene parsed from NCBI nr database KF562854.1-GAPDH N/A KF562854.1
gene parsed from NCBI nr database KF562853.1-GAPDH N/A KF562853.1
gene parsed from NCBI nr database KF562852.1-GAPDH N/A KF562852.1
gene parsed from NCBI nr database KF562851.1-GAPDH N/A KF562851.1
gene parsed from NCBI nr database KF562850.1-GAPDH N/A KF562850.1
gene parsed from NCBI nr database KF562849.1-GAPDH N/A KF562849.1
gene parsed from NCBI nr database KF562848.1-GAPDH N/A KF562848.1
gene parsed from NCBI nr database KF562847.1-GAPDH N/A KF562847.1
gene parsed from NCBI nr database KF562846.1-GAPDH N/A KF562846.1
gene parsed from NCBI nr database KF562845.1-GAPDH N/A KF562845.1
gene parsed from NCBI nr database KF562844.1-GAPDH N/A KF562844.1
gene parsed from NCBI nr database GU575208.1-GAPDH N/A GU575208.1
gene parsed from NCBI nr database GU575207.1-GAPDH N/A GU575207.1
gene parsed from NCBI nr database GU575206.1-GAPDH N/A GU575206.1
gene parsed from NCBI nr database GU575205.1-GAPDH N/A GU575205.1
gene parsed from NCBI nr database GU575204.1-GAPDH N/A GU575204.1
mRNA parsed from NCBI nr database KF562857.1-GAPDH.m1 N/A KF562857.1
mRNA parsed from NCBI nr database KF562856.1-GAPDH.m1 N/A KF562856.1
mRNA parsed from NCBI nr database KF562855.1-GAPDH.m1 N/A KF562855.1
mRNA parsed from NCBI nr database KF562854.1-GAPDH.m1 N/A KF562854.1
mRNA parsed from NCBI nr database KF562853.1-GAPDH.m1 N/A KF562853.1
mRNA parsed from NCBI nr database KF562852.1-GAPDH.m1 N/A KF562852.1
mRNA parsed from NCBI nr database KF562851.1-GAPDH.m1 N/A KF562851.1
mRNA parsed from NCBI nr database KF562850.1-GAPDH.m1 N/A KF562850.1
mRNA parsed from NCBI nr database KF562849.1-GAPDH.m1 N/A KF562849.1
mRNA parsed from NCBI nr database KF562848.1-GAPDH.m1 N/A KF562848.1
mRNA parsed from NCBI nr database KF562847.1-GAPDH.m1 N/A KF562847.1
mRNA parsed from NCBI nr database KF562846.1-GAPDH.m1 N/A KF562846.1
mRNA parsed from NCBI nr database KF562845.1-GAPDH.m1 N/A KF562845.1
mRNA parsed from NCBI nr database KF562844.1-GAPDH.m1 N/A KF562844.1
mRNA parsed from NCBI nr database GU575208.1-GAPDH.m1 N/A GU575208.1
mRNA parsed from NCBI nr database GU575207.1-GAPDH.m1 N/A GU575207.1
mRNA parsed from NCBI nr database GU575206.1-GAPDH.m1 N/A GU575206.1
mRNA parsed from NCBI nr database GU575205.1-GAPDH.m1 N/A GU575205.1
mRNA parsed from NCBI nr database GU575204.1-GAPDH.m1 N/A GU575204.1
gene parsed from NCBI nr database KM353303.1-GAPDH N/A KM353303.1
gene parsed from NCBI nr database KM353302.1-GAPDH N/A KM353302.1
gene parsed from NCBI nr database KM353301.1-GAPDH N/A KM353301.1
gene parsed from NCBI nr database KM353300.1-GAPDH N/A KM353300.1
mRNA parsed from NCBI nr database KM353303.1-GAPDH.m1 N/A KM353303.1
mRNA parsed from NCBI nr database KM353302.1-GAPDH.m1 N/A KM353302.1
mRNA parsed from NCBI nr database KM353301.1-GAPDH.m1 N/A KM353301.1
mRNA parsed from NCBI nr database KM353300.1-GAPDH.m1 N/A KM353300.1

Sequence(s):
>KF562857.1-GAPDH401
tgcatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaaggtact
gcctgctctcaatggcaagttgactggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcatcacattacaatgcgtgtcttggttctaatcttttatctttaattctgtctgaatagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacag
g
back to top
>KF562856.1-GAPDH401
tacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaaggttct
gcctgctctcaatggcaagttgactggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcagcctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacag
g
back to top
>KF562855.1-GAPDH401
tacatgttagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgttggaaaggttct
gcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacag
g
back to top
>KF562854.1-GAPDH401
tgcatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgttggaaaggttct
gcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgactttattggtgacaacag
g
back to top
>KF562853.1-GAPDH401
tgcatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaaggtact
gcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcatcacattacaatgcgtgtctcggttctaatcttttatctttaattctgtctgaatagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacag
g
back to top
>KF562852.1-GAPDH401
tacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgttggaaaggttct
gcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatctattatctttaattctgtctgaacagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacag
g
back to top
>KF562851.1-GAPDH401
tgcatgtcagtgatacttcatctgtaacagctttattaatccttgattgtggaatatctttaggctgtcggcaaggtact
gcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcatcacattacaatgcgtgtcttggttctaatcttttatctttaattctgtctgaatagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacag
g
back to top
>KF562850.1-GAPDH401
tgcatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaaggtact
gcctgctctcaatggcaagttgaccggaatggccttccgcgtgcccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcatcacattacaatgcgtgtcttggttctaatcttttatctttaattctgtctgaatagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacag
g
back to top
>KF562849.1-GAPDH401
tgcatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggcaaggtact
gcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcatcacattacaatgcgtgtcttggttctaatcttttatctttaattctgtctgaatagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacag
g
back to top
>KF562848.1-GAPDH401
tacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaaggttct
gcctgctctcaatggcaagttgactggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacag
g
back to top
>KF562847.1-GAPDH401
tgcatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgttggaaaggttct
gcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacag
g
back to top
>KF562846.1-GAPDH401
tacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgttggaaaggttct
gcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacag
g
back to top
>KF562845.1-GAPDH401
tgcatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaaggtact
gcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcatcacattacaatgcgtgtcttggttctaatcttttatctttaattctgtctgaatagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacag
g
back to top
>KF562844.1-GAPDH401
tgcatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaaggtact
gcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttg
caatcaaggtggggtgtcgtcacattacaatgcgtgtcttggttctaatcttttatctttaattctgtctgaatagggag
gagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacag
g
back to top
>GU575208.1-GAPDH717
catgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccag
aagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagcagcactgg
agctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacttttaagttgcatgtcagtgata
cttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaaggtactgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggt
gtcatcacattacaatgcgtgtcttggttctaatcttttatctttaattctgtctgaatagggaggagtctgagggaaag
ttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacaggtaaatgaatattag
tcatttaatgcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575207.1-GAPDH708
catgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccag
aagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagcagcactgg
agctgccaaggtattttcaatattctttgggccactgcttcagtattgttgatacacttttaagttacatgtcagtgata
cttcatctgtaacagctttattaatccttgattttggaatatctttaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggt
gtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacagggaggagtctgagggaaag
ttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattag
tcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575206.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttgcatgtcagtgatacttcatctgtaacagctttattaatccttga
ttgtggaatatctttaggctgtcggcaaggtactgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcgtgtcttggttct
aatcttttatctttaattctgtctgaatagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaacagacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575205.1-GAPDH725
gagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtattt
gcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatc
attcccagcagcactggagctgccaaggtattttcaatattctttgggccactgcttcagtattgttgatacacttttaa
gttrcatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtyggaaaggtt
ctgcctgctctcaatggcaagttgacyggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgt
cagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagt
tgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacaggg
aggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaac
aggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtgatca
tcttg
back to top
>GU575204.1-GAPDH704
catgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccag
aagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagcagcactgg
agctgccaaggtattttcaatattctttgggccactgcttcagtattgttgatacacttttaagttacatgtcagtgata
cttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtyggaaaggttctgcctgctctcaatgg
caagttgacyggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggt
gtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacagggaggagtctgagggaaag
ttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattag
tcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtgatcat
back to top
>KF562857.1-GAPDH.m1228
gctgtcggaaaggtactgcctgctctcaatggcaagttgactggaatggccttccgcgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacagg
back to top
>KF562856.1-GAPDH.m1228
gctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggccttccgcgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcagcctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacagg
back to top
>KF562855.1-GAPDH.m1228
gctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacagg
back to top
>KF562854.1-GAPDH.m1228
gctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgactttattggtgacaacagg
back to top
>KF562853.1-GAPDH.m1228
gctgtcggaaaggtactgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacagg
back to top
>KF562852.1-GAPDH.m1228
gctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacagg
back to top
>KF562851.1-GAPDH.m1228
gctgtcggcaaggtactgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacagg
back to top
>KF562850.1-GAPDH.m1228
gctgtcggaaaggtactgcctgctctcaatggcaagttgaccggaatggccttccgcgtgcccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacagg
back to top
>KF562849.1-GAPDH.m1228
gctgtcggcaaggtactgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacagg
back to top
>KF562848.1-GAPDH.m1228
gctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggccttccgcgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacagg
back to top
>KF562847.1-GAPDH.m1228
gctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacagg
back to top
>KF562846.1-GAPDH.m1228
gctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacagg
back to top
>KF562845.1-GAPDH.m1228
gctgtcggaaaggtactgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacagg
back to top
>KF562844.1-GAPDH.m1228
gctgtcggaaaggtactgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagt
tgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaaggaggagtctgagggaa
agttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgacaacagg
back to top
>GU575208.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggtactgcctgctctcaatggcaagttgaccggaatggccttccgcgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcattggtgac
aacag
back to top
>GU575207.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgac
aacag
back to top
>GU575206.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggcaaggtactgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaacagacttcattggtgacaacag
back to top
>GU575205.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtyggaaaggttctgcctgctctcaatggcaagttgacyggaatggccttccgcgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgac
aacag
back to top
>GU575204.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtyggaaaggttctgcctgctctcaatggcaagttgacyggaatggccttccgcgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgac
aacag
back to top
>KM353303.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttgcatgtcagtgacacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggtactgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattgcaatgcgtgtcttggttctaatcttttatctttaattctgt
ctgaatagggaggagtctgagggaaagttgaagggcatcttgggttataccgatgaggatgttgtgtcaacagacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353302.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgggccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
tggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353301.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttgcatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggcaaggtactgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcgtgtcttggttctaatcttttatctttaattctgt
ctgaatagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353300.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgggccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
tggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353303.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggtactgcctgctctcaatggcaagttgaccggaatggccttc
cgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttataccgatgaggatgttgtgtcaacagacttca
ttggtgacaacag
back to top
>KM353302.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353301.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggcaaggtactgcctgctctcaatggcaagttgaccggaatggccttc
cgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaacagacttca
ttggtgacaacag
back to top
>KM353300.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top