GAPDH, GAPDH (gene) Rosa odorata var. odorata

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa odorata var. odorata
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575177.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575176.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575175.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575174.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575173.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575172.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575171.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575170.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575169.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575168.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575167.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575166.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575165.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575164.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575163.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575162.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575161.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575160.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575159.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575158.1-GAPDHRosa odorata var. odoratagene
GAPDHGU575157.1-GAPDHRosa odorata var. odoratagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575177.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575176.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575175.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575174.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575173.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575172.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575171.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575170.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575169.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575168.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575167.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575166.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575165.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575164.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575163.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575162.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575161.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575160.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575159.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575158.1-GAPDH.m1Rosa odorata var. odoratamRNA
GAPDHGU575157.1-GAPDH.m1Rosa odorata var. odoratamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa odorata var. odoratagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575177.1-GAPDH N/A GU575177.1
gene parsed from NCBI nr database GU575176.1-GAPDH N/A GU575176.1
gene parsed from NCBI nr database GU575175.1-GAPDH N/A GU575175.1
gene parsed from NCBI nr database GU575174.1-GAPDH N/A GU575174.1
gene parsed from NCBI nr database GU575173.1-GAPDH N/A GU575173.1
gene parsed from NCBI nr database GU575172.1-GAPDH N/A GU575172.1
gene parsed from NCBI nr database GU575171.1-GAPDH N/A GU575171.1
gene parsed from NCBI nr database GU575170.1-GAPDH N/A GU575170.1
gene parsed from NCBI nr database GU575169.1-GAPDH N/A GU575169.1
gene parsed from NCBI nr database GU575168.1-GAPDH N/A GU575168.1
gene parsed from NCBI nr database GU575167.1-GAPDH N/A GU575167.1
gene parsed from NCBI nr database GU575166.1-GAPDH N/A GU575166.1
gene parsed from NCBI nr database GU575165.1-GAPDH N/A GU575165.1
gene parsed from NCBI nr database GU575164.1-GAPDH N/A GU575164.1
gene parsed from NCBI nr database GU575163.1-GAPDH N/A GU575163.1
gene parsed from NCBI nr database GU575162.1-GAPDH N/A GU575162.1
gene parsed from NCBI nr database GU575161.1-GAPDH N/A GU575161.1
gene parsed from NCBI nr database GU575160.1-GAPDH N/A GU575160.1
gene parsed from NCBI nr database GU575159.1-GAPDH N/A GU575159.1
gene parsed from NCBI nr database GU575158.1-GAPDH N/A GU575158.1
gene parsed from NCBI nr database GU575157.1-GAPDH N/A GU575157.1
mRNA parsed from NCBI nr database GU575177.1-GAPDH.m1 N/A GU575177.1
mRNA parsed from NCBI nr database GU575176.1-GAPDH.m1 N/A GU575176.1
mRNA parsed from NCBI nr database GU575175.1-GAPDH.m1 N/A GU575175.1
mRNA parsed from NCBI nr database GU575174.1-GAPDH.m1 N/A GU575174.1
mRNA parsed from NCBI nr database GU575173.1-GAPDH.m1 N/A GU575173.1
mRNA parsed from NCBI nr database GU575172.1-GAPDH.m1 N/A GU575172.1
mRNA parsed from NCBI nr database GU575171.1-GAPDH.m1 N/A GU575171.1
mRNA parsed from NCBI nr database GU575170.1-GAPDH.m1 N/A GU575170.1
mRNA parsed from NCBI nr database GU575169.1-GAPDH.m1 N/A GU575169.1
mRNA parsed from NCBI nr database GU575168.1-GAPDH.m1 N/A GU575168.1
mRNA parsed from NCBI nr database GU575167.1-GAPDH.m1 N/A GU575167.1
mRNA parsed from NCBI nr database GU575166.1-GAPDH.m1 N/A GU575166.1
mRNA parsed from NCBI nr database GU575165.1-GAPDH.m1 N/A GU575165.1
mRNA parsed from NCBI nr database GU575164.1-GAPDH.m1 N/A GU575164.1
mRNA parsed from NCBI nr database GU575163.1-GAPDH.m1 N/A GU575163.1
mRNA parsed from NCBI nr database GU575162.1-GAPDH.m1 N/A GU575162.1
mRNA parsed from NCBI nr database GU575161.1-GAPDH.m1 N/A GU575161.1
mRNA parsed from NCBI nr database GU575160.1-GAPDH.m1 N/A GU575160.1
mRNA parsed from NCBI nr database GU575159.1-GAPDH.m1 N/A GU575159.1
mRNA parsed from NCBI nr database GU575158.1-GAPDH.m1 N/A GU575158.1
mRNA parsed from NCBI nr database GU575157.1-GAPDH.m1 N/A GU575157.1

Sequence(s):
>GU575177.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatctattatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575176.1-GAPDH758
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaactttgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taattgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacaga
ataaaccatctatgctgttcggattagtgatcatcttg
back to top
>GU575175.1-GAPDH758
gtcttatgactaccgtgcactccatcactggtgagctttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaactttgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taattgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacaga
ataaaccatctatgctgttcggattagtgatcatcttg
back to top
>GU575174.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatctattatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccaatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575173.1-GAPDH759
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagctgttgacctcactgtcagacttgagaagaacgcaacctatgaccagatcaaggctgctattaa
ttaaggcttgttgaacttttgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgccttggtt
ctaattgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatga
ggatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacag
aataaaccatctatgctgttcggatttgtgatcatcttg
back to top
>GU575172.1-GAPDH551
ggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacttttaagttacatgtcagtga
tacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtcggaaaggttctgcctgctctcaat
ggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaa
ggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgttgttaattaagttgtaatcaaggtgg
ggtgtcatcacattacaatgcatgtcttggttctaattgtttatctttaattctgtctcaacagggaggagtctgaggga
aagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatat
tagtcatttaatggtaggagtactacgtacagaataaaccatctatgctgttcggattagtgatcatcttg
back to top
>GU575171.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgtatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575170.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgtatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575169.1-GAPDH758
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaactttgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taattgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttgcaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacaga
ataaaccatctatgctgttcggattagtgatcatcttg
back to top
>GU575168.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaaccaatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575167.1-GAPDH758
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttctggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaactttgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taattgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacaga
ataaaccatctatgctgttcggattagtgatcatcttg
back to top
>GU575166.1-GAPDH758
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaactttgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taattgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacaga
ataaaccatctatgctgttcggattagtgatcatcttg
back to top
>GU575165.1-GAPDH754
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatc
back to top
>GU575164.1-GAPDH754
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatc
back to top
>GU575163.1-GAPDH818
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactatgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaa
agtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgc
tgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtatt
gttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattcttgaatatcttta
ggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcag
ttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaac
tttgttgttaattaagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatcttta
attctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccg
acttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtattacgtacagaataaaccatctatgct
gttcggattagtgatcat
back to top
>GU575162.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccagggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575161.1-GAPDH822
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactatgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaa
agtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgc
tgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtatt
gttgatacacttttaagttacatgtcagtgatacttcatctgcaacagctttattaatccttgactcttgaatatcttta
ggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcag
ttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaac
tttgttgttaattaagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatcttta
attctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccg
acttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtattacgtacagaataaaccatctatgct
gttcggattagtgatcatcttg
back to top
>GU575160.1-GAPDH804
actccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactatga
gttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgtctgtgtatttgc
aattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcat
tcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacttttaagt
tacatgtcagtgatacttcatctgtaacagctttattaatccttgattcttgaatatctttaggctgtcggaaaggttct
gcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtca
gacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgttgttaattaagtt
gcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatctttaattctgtctcaacaggga
ggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaaca
ggtaaatgaatattagtcatttaatggtaggagtattacgtacagaataaaccatctatgctgttcggattagtgatcat
cttg
back to top
>GU575159.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575158.1-GAPDH822
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactatgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaa
agtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgc
tgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtatt
gttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattcttgaatatcttta
ggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgcttcag
ttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaac
tttgttgttaattaagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatcttta
attctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccg
acttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtattacgtacagaataaaccatctatgct
gttcggattagtgatcatcttg
back to top
>GU575157.1-GAPDH822
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactatgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaa
agtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgc
tgcctcattcaacatcattcccagcagcactggagccgccaaggtattttcaatattctttgtgccactgcttcagtatt
gttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattcttgaatatcttta
ggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcag
ttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaac
tttgttgttaattaagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatcttta
attctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccg
acttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtattacgtacagaataaaccatctatgct
gttcggattagtgatcatcttg
back to top
>GU575177.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575176.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575175.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575174.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccaatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575173.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagctgttgacctcactgtcagacttgagaagaacg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575172.1-GAPDH.m1239
ggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgt
tgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaaggagg
agtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575171.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575170.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575169.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttgcaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575168.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caaccaatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575167.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575166.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575165.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575164.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575163.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575162.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccagggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575161.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575160.1-GAPDH.m1337
actccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaac
atcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggc
cttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatca
aggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgac
ttcattggtgacaacag
back to top
>GU575159.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575158.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgcttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575157.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagccgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top