GAPDH, GAPDH (gene) Rosa odorata var. pseudindica

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa odorata var. pseudindica
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575203.1-GAPDHRosa odorata var. pseudindicagene
GAPDHGU575202.1-GAPDHRosa odorata var. pseudindicagene
GAPDHGU575201.1-GAPDHRosa odorata var. pseudindicagene
GAPDHGU575200.1-GAPDHRosa odorata var. pseudindicagene
GAPDHGU575199.1-GAPDHRosa odorata var. pseudindicagene
GAPDHGU575198.1-GAPDHRosa odorata var. pseudindicagene
GAPDHGU575197.1-GAPDHRosa odorata var. pseudindicagene
GAPDHGU575196.1-GAPDHRosa odorata var. pseudindicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575203.1-GAPDH.m1Rosa odorata var. pseudindicamRNA
GAPDHGU575202.1-GAPDH.m1Rosa odorata var. pseudindicamRNA
GAPDHGU575201.1-GAPDH.m1Rosa odorata var. pseudindicamRNA
GAPDHGU575200.1-GAPDH.m1Rosa odorata var. pseudindicamRNA
GAPDHGU575199.1-GAPDH.m1Rosa odorata var. pseudindicamRNA
GAPDHGU575198.1-GAPDH.m1Rosa odorata var. pseudindicamRNA
GAPDHGU575197.1-GAPDH.m1Rosa odorata var. pseudindicamRNA
GAPDHGU575196.1-GAPDH.m1Rosa odorata var. pseudindicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa odorata var. pseudindicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575203.1-GAPDH N/A GU575203.1
gene parsed from NCBI nr database GU575202.1-GAPDH N/A GU575202.1
gene parsed from NCBI nr database GU575201.1-GAPDH N/A GU575201.1
gene parsed from NCBI nr database GU575200.1-GAPDH N/A GU575200.1
gene parsed from NCBI nr database GU575199.1-GAPDH N/A GU575199.1
gene parsed from NCBI nr database GU575198.1-GAPDH N/A GU575198.1
gene parsed from NCBI nr database GU575197.1-GAPDH N/A GU575197.1
gene parsed from NCBI nr database GU575196.1-GAPDH N/A GU575196.1
mRNA parsed from NCBI nr database GU575203.1-GAPDH.m1 N/A GU575203.1
mRNA parsed from NCBI nr database GU575202.1-GAPDH.m1 N/A GU575202.1
mRNA parsed from NCBI nr database GU575201.1-GAPDH.m1 N/A GU575201.1
mRNA parsed from NCBI nr database GU575200.1-GAPDH.m1 N/A GU575200.1
mRNA parsed from NCBI nr database GU575199.1-GAPDH.m1 N/A GU575199.1
mRNA parsed from NCBI nr database GU575198.1-GAPDH.m1 N/A GU575198.1
mRNA parsed from NCBI nr database GU575197.1-GAPDH.m1 N/A GU575197.1
mRNA parsed from NCBI nr database GU575196.1-GAPDH.m1 N/A GU575196.1

Sequence(s):
>GU575203.1-GAPDH758
gtcttatgactaccgtgcactccaccactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaactttgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taattgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacaga
ataaaccatctatgctgttcggattagtgatcatcttg
back to top
>GU575202.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcgttggtgacaacaggtagatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575201.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgtcaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575200.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575199.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575198.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaggtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575197.1-GAPDH757
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttggg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatactccatctgtaacagctttattaatccttga
ttttggaatatctttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgcgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagaccaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575196.1-GAPDH758
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagataccag
atttgaaacctactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttga
ttttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaa
gtaaggcttgttgaactttgttgttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttc
taattgtttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactacgtacaga
ataaaccatctatgctgttcggattagtgatcatcttg
back to top
>GU575203.1-GAPDH.m1355
gtcttatgactaccgtgcactccaccactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575202.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcgttggtgacaacag
back to top
>GU575201.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575200.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575199.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575198.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575197.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgcgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagaccaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>GU575196.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top