GAPDH, GAPDH (gene) Rosa pisocarpa

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa pisocarpa
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091073.1-GAPDHRosa pisocarpagene
GAPDHDQ091072.1-GAPDHRosa pisocarpagene
GAPDHDQ091071.1-GAPDHRosa pisocarpagene
GAPDHDQ091070.1-GAPDHRosa pisocarpagene
GAPDHDQ091069.1-GAPDHRosa pisocarpagene
GAPDHDQ091068.1-GAPDHRosa pisocarpagene
GAPDHEU315082.1-GAPDHRosa pisocarpagene
GAPDHEU315081.1-GAPDHRosa pisocarpagene
GAPDHEU315080.1-GAPDHRosa pisocarpagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091073.1-GAPDH.m1Rosa pisocarpamRNA
GAPDHDQ091072.1-GAPDH.m1Rosa pisocarpamRNA
GAPDHDQ091071.1-GAPDH.m1Rosa pisocarpamRNA
GAPDHDQ091070.1-GAPDH.m1Rosa pisocarpamRNA
GAPDHDQ091069.1-GAPDH.m1Rosa pisocarpamRNA
GAPDHDQ091068.1-GAPDH.m1Rosa pisocarpamRNA
GAPDHEU315082.1-GAPDH.m1Rosa pisocarpamRNA
GAPDHEU315081.1-GAPDH.m1Rosa pisocarpamRNA
GAPDHEU315080.1-GAPDH.m1Rosa pisocarpamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa pisocarpagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ091073.1-GAPDH N/A DQ091073.1
gene parsed from NCBI nr database DQ091072.1-GAPDH N/A DQ091072.1
gene parsed from NCBI nr database DQ091071.1-GAPDH N/A DQ091071.1
gene parsed from NCBI nr database DQ091070.1-GAPDH N/A DQ091070.1
gene parsed from NCBI nr database DQ091069.1-GAPDH N/A DQ091069.1
gene parsed from NCBI nr database DQ091068.1-GAPDH N/A DQ091068.1
gene parsed from NCBI nr database EU315082.1-GAPDH N/A EU315082.1
gene parsed from NCBI nr database EU315081.1-GAPDH N/A EU315081.1
gene parsed from NCBI nr database EU315080.1-GAPDH N/A EU315080.1
mRNA parsed from NCBI nr database DQ091073.1-GAPDH.m1 N/A DQ091073.1
mRNA parsed from NCBI nr database DQ091072.1-GAPDH.m1 N/A DQ091072.1
mRNA parsed from NCBI nr database DQ091071.1-GAPDH.m1 N/A DQ091071.1
mRNA parsed from NCBI nr database DQ091070.1-GAPDH.m1 N/A DQ091070.1
mRNA parsed from NCBI nr database DQ091069.1-GAPDH.m1 N/A DQ091069.1
mRNA parsed from NCBI nr database DQ091068.1-GAPDH.m1 N/A DQ091068.1
mRNA parsed from NCBI nr database EU315082.1-GAPDH.m1 N/A EU315082.1
mRNA parsed from NCBI nr database EU315081.1-GAPDH.m1 N/A EU315081.1
mRNA parsed from NCBI nr database EU315080.1-GAPDH.m1 N/A EU315080.1

Sequence(s):
>DQ091073.1-GAPDH742
ctggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtg
tatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattca
acatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacact
tgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaa
aggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctc
actgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgttaattagttgcaa
tcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaacagggaggag
tctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgacaacaggta
aatgaatattagtcatttaatggttggagtactacgtacagaataaaccatccatgctgtttggattagtggtcatcttg
aagttgcagtgatgaatttatt
back to top
>DQ091072.1-GAPDH752
ctggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagttgtctgtg
tatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattca
acatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacact
tgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaa
aggttctgcctgctctcaatggtaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctc
actgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaa
ttagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatctttaatctttaattctgtctcaa
cagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatccatgctgtttggattagt
ggtcatcttgaagttgcagtgatgaatttatt
back to top
>DQ091071.1-GAPDH752
ctggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagttgtctgtg
tatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattca
acatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacact
tgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaa
aggttctgcctgctctcaatggtaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctc
actgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaa
ttagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatctttaatctttaattctgtctcaa
cagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatccatgctgtttggattagt
ggtcatcttgaagttgcagtgatgaatttatt
back to top
>DQ091070.1-GAPDH752
ctggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtg
tatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattca
acatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacact
tgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaa
aggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctc
actgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaa
ttagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaa
cagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggtg
acaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatccatgctgtttggattagt
ggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091069.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatggtaagatactag
atttgaaaccaactaaagtcgtatgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggtaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatccatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091068.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatccatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>EU315082.1-GAPDH749
gtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtat
ttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaaca
tcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacttgt
aagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcact
gtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaatta
gttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgtctcaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgaca
acaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtggt
catcttgaagttgcagtggtgaatttatt
back to top
>EU315081.1-GAPDH749
gtgagttttcacttgtaaccatgtgagatatatgaatggtaagatactagatttgaaaccaactaaagtcgtatgtgtat
ttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaaca
tcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacttgt
aagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaagg
ttctgcctgctctcaatggtaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcact
gtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaatta
gttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgaca
acaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatccatgctgtttggattagtggt
catcttgaagttgcagtggtgaatttatt
back to top
>EU315080.1-GAPDH749
gtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtatgtgtat
ttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaaca
tcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacttgt
aagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcact
gtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaatta
gttgcaatcaaggtggggtgtcatgacattacaatgtatgtcttggttctaatcttttgtctttaattctgtctcaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgaca
acaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtggt
catcttgaagttgcagtggtgaatttatt
back to top
>DQ091073.1-GAPDH.m1328
ctgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccc
agcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgt
acccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgcta
tcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggt
gacaacag
back to top
>DQ091072.1-GAPDH.m1328
ctgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccc
agcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggtaagttgaccggaatggccttccgtgt
acccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgcta
tcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggt
gacaacag
back to top
>DQ091071.1-GAPDH.m1328
ctgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccc
agcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggtaagttgaccggaatggccttccgtgt
acccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgcta
tcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggt
gacaacag
back to top
>DQ091070.1-GAPDH.m1328
ctgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccc
agcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgt
acccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgcta
tcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcattggt
gacaacag
back to top
>DQ091069.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
taagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091068.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>EU315082.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgac
aacag
back to top
>EU315081.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggtaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgac
aacag
back to top
>EU315080.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgac
aacag
back to top