GAPDH, GAPDH (gene) Rosa roxburghii

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa roxburghii
Synonym glyceraldehyde-3-phosphate dehydrogenase
glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575221.1-GAPDHRosa roxburghiigene
GAPDHKM353410.1-GAPDHRosa roxburghiigene
GAPDHKM353409.1-GAPDHRosa roxburghiigene
GAPDHKJ575402.1-GAPDHRosa roxburghiigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHJQ178265.1-GAPDH.m1Rosa roxburghiimRNA
GAPDHGU575221.1-GAPDH.m1Rosa roxburghiimRNA
GAPDHKM353410.1-GAPDH.m1Rosa roxburghiimRNA
GAPDHKM353409.1-GAPDH.m1Rosa roxburghiimRNA
GAPDHKJ575402.1-GAPDH.m1Rosa roxburghiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa roxburghiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575221.1-GAPDH N/A GU575221.1
mRNA parsed from NCBI nr database JQ178265.1-GAPDH.m1 N/A JQ178265.1
mRNA parsed from NCBI nr database GU575221.1-GAPDH.m1 N/A GU575221.1
gene parsed from NCBI nr database KM353410.1-GAPDH N/A KM353410.1
gene parsed from NCBI nr database KM353409.1-GAPDH N/A KM353409.1
gene parsed from NCBI nr database KJ575402.1-GAPDH N/A KJ575402.1
mRNA parsed from NCBI nr database KM353410.1-GAPDH.m1 N/A KM353410.1
mRNA parsed from NCBI nr database KM353409.1-GAPDH.m1 N/A KM353409.1
mRNA parsed from NCBI nr database KJ575402.1-GAPDH.m1 N/A KJ575402.1

Sequence(s):
>GU575221.1-GAPDH695
gtcttatgactactgtgcactccatcactggtgagttttcacttgtgtccatgtgagatttatcaatgttaatcatttgc
atgttttgaaactaactgaagtcgtctgtgtatttgtaactcagccacccagaagactgttgatggaccatcagccaagg
actggaggggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattcttc
atgtgactgcttcaatattgttgatacatttttaagttacatgtcaatgatacttcatctttaacagctttattaatcct
tgattttggaatatgtttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcaccgtcagacttgagaaggcggcaacctatgaccagatcaaggctgccat
caagtaaggcttgttgaactttgttgtcaatcagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggt
tctaatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatg
aggatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtca
back to top
>JQ178265.1-GAPDH.m1121
atttggaatcgttgagggtcttatgactactgtgcactccatcactgccacccagaagactgttgatggaccatcagcca
aggactggaggggtggacgtgctgcttccttcaacatcatt
back to top
>GU575221.1-GAPDH.m1355
gtcttatgactactgtgcactccatcactgccacccagaagactgttgatggaccatcagccaaggactggaggggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcaccgtcagacttgagaaggcgg
caacctatgaccagatcaaggctgccatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top
>KM353410.1-GAPDH760
catcactggtgagttttcacttgtgtccatgtgagatttatcaatgttaatcatttgcatgttttgaaactaactgaagt
cgtctgtgtatttgtaactcagccacccagaagactgttgatggaccatcagccaaggactggaggggtggacgtgctgc
ctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattcttcatgtgactgcttcaatattgtt
gatacatttttaagttacatgtcaatgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggc
tgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttg
ttgacctcaccgtcagacttgagaaggcggcaacctatgaccagatcaaggctgccatcaagtaaggcttgttgaacttt
gttgtcaatcagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattc
tgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgactt
cattggtgacaacaggtaaatgaatattagtcactcaatggttggagtactatgtacagaataaaccatctattctgttt
ggattagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353409.1-GAPDH760
caccactggtgagttttcacttgtgtccatgtgagatttatcaatgttaatcatttgcatgttttgaaactaactgaagt
cgtctgtgtatttgtaactcagccacccagaagactgttgatggaccatcagccaaggactggaagggtggacgtgctgc
ctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattcttcatgtgactgctacaatattgtt
gatacatttttaagttacatgtcaatgatatttcatctttaacagctttattaatccttgattttggaatatgtttaggc
tgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttg
ttgacctcaccgtcagacttgagaaggcggcaacctatgaccagatcaaggctgccatcaagtaaggcttgttgaacttt
gttgtcaatcagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattc
tgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgactt
cattggtgacaacaggtaaatgaatattagtcactcaatggttggagtactatgtacagaataaaccatctattctgttt
ggattagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KJ575402.1-GAPDH677
gtcttatgactactgtgcactccatcactggtgagttttcacttgtgtccatgtgagatttatcaatgttaatcatttgc
atgttttgaaactaactgaagtcgtctgtgtatttgtaactcagccacccagaagactgttgatggaccatcagccaagg
actggaggggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattcttc
atgtgactgcttcaatattgttgatacatttttaagttacatgtcaatgatacttcatctttaacagctttattaatcct
tgattttggaatatgtttaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcaccgtcagacttgagaaggcggcaacctatgaccagatcaaggctgccat
caagtaaggcttgttgaactttgttgtcaatcagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggt
tctaatcttttatctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatg
aggatgttgtgtcaaccgacttcattggtgacaacag
back to top
>KM353410.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagccaaggactggaggggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcaccgtcagacttgagaaggcggcaacctatgaccagatcaaggc
tgccatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353409.1-GAPDH.m1333
caccactgccacccagaagactgttgatggaccatcagccaaggactggaagggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcaccgtcagacttgagaaggcggcaacctatgaccagatcaaggc
tgccatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KJ575402.1-GAPDH.m1355
gtcttatgactactgtgcactccatcactgccacccagaagactgttgatggaccatcagccaaggactggaggggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgttggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcaccgtcagacttgagaaggcgg
caacctatgaccagatcaaggctgccatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top