GAPDH, GAPDH (gene) Rosa rubus

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa rubus
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575226.1-GAPDHRosa rubusgene
GAPDHKM353421.1-GAPDHRosa rubusgene
GAPDHKM353420.1-GAPDHRosa rubusgene
GAPDHKM353419.1-GAPDHRosa rubusgene
GAPDHKM353418.1-GAPDHRosa rubusgene
GAPDHKM353417.1-GAPDHRosa rubusgene
GAPDHKM353416.1-GAPDHRosa rubusgene
GAPDHKM353415.1-GAPDHRosa rubusgene
GAPDHKM353414.1-GAPDHRosa rubusgene
GAPDHKM353413.1-GAPDHRosa rubusgene
GAPDHKM353412.1-GAPDHRosa rubusgene
GAPDHKM353411.1-GAPDHRosa rubusgene
GAPDHKJ575347.1-GAPDHRosa rubusgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575226.1-GAPDH.m1Rosa rubusmRNA
GAPDHKM353421.1-GAPDH.m1Rosa rubusmRNA
GAPDHKM353420.1-GAPDH.m1Rosa rubusmRNA
GAPDHKM353419.1-GAPDH.m1Rosa rubusmRNA
GAPDHKM353418.1-GAPDH.m1Rosa rubusmRNA
GAPDHKM353417.1-GAPDH.m1Rosa rubusmRNA
GAPDHKM353416.1-GAPDH.m1Rosa rubusmRNA
GAPDHKM353415.1-GAPDH.m1Rosa rubusmRNA
GAPDHKM353414.1-GAPDH.m1Rosa rubusmRNA
GAPDHKM353413.1-GAPDH.m1Rosa rubusmRNA
GAPDHKM353412.1-GAPDH.m1Rosa rubusmRNA
GAPDHKM353411.1-GAPDH.m1Rosa rubusmRNA
GAPDHKJ575347.1-GAPDH.m1Rosa rubusmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa rubusgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575226.1-GAPDH N/A GU575226.1
mRNA parsed from NCBI nr database GU575226.1-GAPDH.m1 N/A GU575226.1
gene parsed from NCBI nr database KM353421.1-GAPDH N/A KM353421.1
gene parsed from NCBI nr database KM353420.1-GAPDH N/A KM353420.1
gene parsed from NCBI nr database KM353419.1-GAPDH N/A KM353419.1
gene parsed from NCBI nr database KM353418.1-GAPDH N/A KM353418.1
gene parsed from NCBI nr database KM353417.1-GAPDH N/A KM353417.1
gene parsed from NCBI nr database KM353416.1-GAPDH N/A KM353416.1
gene parsed from NCBI nr database KM353415.1-GAPDH N/A KM353415.1
gene parsed from NCBI nr database KM353414.1-GAPDH N/A KM353414.1
gene parsed from NCBI nr database KM353413.1-GAPDH N/A KM353413.1
gene parsed from NCBI nr database KM353412.1-GAPDH N/A KM353412.1
gene parsed from NCBI nr database KM353411.1-GAPDH N/A KM353411.1
gene parsed from NCBI nr database KJ575347.1-GAPDH N/A KJ575347.1
mRNA parsed from NCBI nr database KM353421.1-GAPDH.m1 N/A KM353421.1
mRNA parsed from NCBI nr database KM353420.1-GAPDH.m1 N/A KM353420.1
mRNA parsed from NCBI nr database KM353419.1-GAPDH.m1 N/A KM353419.1
mRNA parsed from NCBI nr database KM353418.1-GAPDH.m1 N/A KM353418.1
mRNA parsed from NCBI nr database KM353417.1-GAPDH.m1 N/A KM353417.1
mRNA parsed from NCBI nr database KM353416.1-GAPDH.m1 N/A KM353416.1
mRNA parsed from NCBI nr database KM353415.1-GAPDH.m1 N/A KM353415.1
mRNA parsed from NCBI nr database KM353414.1-GAPDH.m1 N/A KM353414.1
mRNA parsed from NCBI nr database KM353413.1-GAPDH.m1 N/A KM353413.1
mRNA parsed from NCBI nr database KM353412.1-GAPDH.m1 N/A KM353412.1
mRNA parsed from NCBI nr database KM353411.1-GAPDH.m1 N/A KM353411.1
mRNA parsed from NCBI nr database KJ575347.1-GAPDH.m1 N/A KJ575347.1

Sequence(s):
>GU575226.1-GAPDH756
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactaga
tttgaaaccaactaaagtcatctgtgtatttgtaattcagccacccagaagactgttgatggaccatcagcaaaggactg
gagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatrttctttgtgc
cactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaat
tttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccca
ctgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaag
taaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacatcacaatgcatgtcttggttcta
atcttttatgtttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagga
tgttgtgtcaaccgacttcattggtgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaat
aaaccatctatgctgtttggattagtgatcatcttg
back to top
>GU575226.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaatag
back to top
>KM353421.1-GAPDH708
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggactatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattatgt
ctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaattgtcatttaatggtaggagtactacgtacagaataaaccatctatg
back to top
>KM353420.1-GAPDH747
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtgatcacatcacaatgcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggat
tagtgatcatcttgtggtgaatatatt
back to top
>KM353419.1-GAPDH747
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtcatcacatcacaatgcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggat
tagtgatcatcttgtggtgaatatatt
back to top
>KM353418.1-GAPDH747
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttttaagttgcatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtcatcacatcacaatgcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggat
tagtgatcatcttgtggtgaatatatt
back to top
>KM353417.1-GAPDH745
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggactatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattatgt
ctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaattgtcatttaatggtaggagtactacgtacagaataaaccatctatgctgtttggatta
gtgatcatcctgtggtgaatttatt
back to top
>KM353416.1-GAPDH749
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaacctactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaagtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
tggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctattaagtaaggcttgttgaactttgtt
gttaattaagttgtaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcgtttatctttaattctg
tctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacaggtaaatgaatattagtcatttaatggtaggagtactatgtacagaataaaccatctatgctgttcgg
attagtgatcatcttgtggtgaatttatt
back to top
>KM353415.1-GAPDH648
catcactggtgagttttcgcttgtaaccatgtgagatatatgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaatttagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatgttctttgtgccactgcttcagtattgttgata
cacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgactggaatggcattccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtcatcacatcacaatgcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaa
back to top
>KM353414.1-GAPDH648
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgactggaatggcattccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtcatcacatcacaatgcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaa
back to top
>KM353413.1-GAPDH648
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaatttagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgactggaatggcattccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtcatcacatcacaatgcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaa
back to top
>KM353412.1-GAPDH747
catcactggtgagttttcacttgtaaccatgtgagatatgtgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttg
ttaattagttgcaatcaaggtggggtgtcatcacatcacaatgcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgcttcttggat
tagtgatcatcttgtggtgaatttatt
back to top
>KM353411.1-GAPDH747
catcactggtgagttttcacttgtaaccatgtgagatatgtgaatgttaaatactagatttgaaaccaactaaagtcatc
tgtgtatttgtaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctca
ttcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgata
cacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaattttggaatatctttaggctgtc
ggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttga
cctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactctgttg
ttaattagttgcaatcaaggtggggtgtcatcacatcacaatgcatgtcttggttctaatcttttatgtttaattctgtc
tgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcatt
ggtgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgcttcttggat
tagtgatcatcttgtggtgaatttatt
back to top
>KJ575347.1-GAPDH673
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaaatactaga
tttgaaaccaactaaagtcatctgtgtatttgtaatttagccacccagaagactgttgatggaccatcagcaaaggactg
gagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgc
cactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttaat
tttggaatatctttaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggcattccgtgtaccca
ctgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaag
taaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacatcacaatgcatgtcttggttcta
atcttttatgtttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagga
tgttgtgtcaaccgacttcattggtgacaatag
back to top
>KM353421.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353420.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KM353419.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KM353418.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KM353417.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353416.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaagctgttggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctattaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353415.1-GAPDH.m1330
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggcattc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaa
back to top
>KM353414.1-GAPDH.m1330
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggcattc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaa
back to top
>KM353413.1-GAPDH.m1330
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgactggaatggcattc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaa
back to top
>KM353412.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KM353411.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KJ575347.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgactggaatggcattccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaatag
back to top