GAPDH, GAPDH (gene) Rosa soulieana

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa soulieana
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575234.1-GAPDHRosa soulieanagene
GAPDHKM353448.1-GAPDHRosa soulieanagene
GAPDHKM353447.1-GAPDHRosa soulieanagene
GAPDHKM353446.1-GAPDHRosa soulieanagene
GAPDHKM353445.1-GAPDHRosa soulieanagene
GAPDHKM353444.1-GAPDHRosa soulieanagene
GAPDHKM353443.1-GAPDHRosa soulieanagene
GAPDHKM353442.1-GAPDHRosa soulieanagene
GAPDHKM353441.1-GAPDHRosa soulieanagene
GAPDHKJ575413.1-GAPDHRosa soulieanagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHGU575234.1-GAPDH.m1Rosa soulieanamRNA
GAPDHKM353448.1-GAPDH.m1Rosa soulieanamRNA
GAPDHKM353447.1-GAPDH.m1Rosa soulieanamRNA
GAPDHKM353446.1-GAPDH.m1Rosa soulieanamRNA
GAPDHKM353445.1-GAPDH.m1Rosa soulieanamRNA
GAPDHKM353444.1-GAPDH.m1Rosa soulieanamRNA
GAPDHKM353443.1-GAPDH.m1Rosa soulieanamRNA
GAPDHKM353442.1-GAPDH.m1Rosa soulieanamRNA
GAPDHKM353441.1-GAPDH.m1Rosa soulieanamRNA
GAPDHKJ575413.1-GAPDH.m1Rosa soulieanamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa soulieanagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU575234.1-GAPDH N/A GU575234.1
mRNA parsed from NCBI nr database GU575234.1-GAPDH.m1 N/A GU575234.1
gene parsed from NCBI nr database KM353448.1-GAPDH N/A KM353448.1
gene parsed from NCBI nr database KM353447.1-GAPDH N/A KM353447.1
gene parsed from NCBI nr database KM353446.1-GAPDH N/A KM353446.1
gene parsed from NCBI nr database KM353445.1-GAPDH N/A KM353445.1
gene parsed from NCBI nr database KM353444.1-GAPDH N/A KM353444.1
gene parsed from NCBI nr database KM353443.1-GAPDH N/A KM353443.1
gene parsed from NCBI nr database KM353442.1-GAPDH N/A KM353442.1
gene parsed from NCBI nr database KM353441.1-GAPDH N/A KM353441.1
gene parsed from NCBI nr database KJ575413.1-GAPDH N/A KJ575413.1
mRNA parsed from NCBI nr database KM353448.1-GAPDH.m1 N/A KM353448.1
mRNA parsed from NCBI nr database KM353447.1-GAPDH.m1 N/A KM353447.1
mRNA parsed from NCBI nr database KM353446.1-GAPDH.m1 N/A KM353446.1
mRNA parsed from NCBI nr database KM353445.1-GAPDH.m1 N/A KM353445.1
mRNA parsed from NCBI nr database KM353444.1-GAPDH.m1 N/A KM353444.1
mRNA parsed from NCBI nr database KM353443.1-GAPDH.m1 N/A KM353443.1
mRNA parsed from NCBI nr database KM353442.1-GAPDH.m1 N/A KM353442.1
mRNA parsed from NCBI nr database KM353441.1-GAPDH.m1 N/A KM353441.1
mRNA parsed from NCBI nr database KJ575413.1-GAPDH.m1 N/A KJ575413.1

Sequence(s):
>GU575234.1-GAPDH691
ttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtatttgcaattcagc
cacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagca
gcactggagctgccaaggtattttcaatrttctttgtgccactgcttcagtattgttgatacacttttaagttacatgtc
agtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgtyggaaaggttctacctgctc
tcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgag
aagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaag
gtggggtgtcaccacattacaatgcatgtcttggttctaatcttttatctttaattctgtctgaacagggaggagtctga
gggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgacaacaggtaaatga
atattagtcatttaatggttggagtactacgtacagaataaaccatctatg
back to top
>GU575234.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtyggaaaggttctacctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgac
aacag
back to top
>KM353448.1-GAPDH791
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
tggaaaggttctacctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttgtttctaatcttttatctttaataatct
tttatctttaataatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggtt
acaccgatgaggatgttgtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagta
ctacgttcagaataaaccatctatgctgtttggattagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353447.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgctaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcatttccagcagcactggtgctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctacctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaagacttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcaccacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtccgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgttcagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353446.1-GAPDH774
catcactggtgagttttcacttgtaaccatgtgaggtatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctacctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttgtttctaatcttttatctttaataatct
tttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcctgggttacaccgatgaggatgtt
gtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgttcagaataaac
catctatgctgtttggattagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353445.1-GAPDH745
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgctaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggtgctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctacctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaagacttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcaccacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtccgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgtttggatta
gtgatcatcttgtggtgaatttatt
back to top
>KM353444.1-GAPDH757
catcactggtgagttttcaattgtaaccatgtgaggtatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatgttctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctacctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaattttgtt
gttaattagttgcaatcaaggtggggtgtcaccacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353443.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagctaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttgtttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgttcagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353442.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagttactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagctaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttggttctaatcttttatctttaattctgt
ctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttcat
tggtgacaataggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KM353441.1-GAPDH774
catcactggtgagttttcacttgtaaccatgtgaggtatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgattttggaatatctttaggctgt
cggaaaggttctacctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttgtttctaatcttttatctttaataatct
tttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgtt
gtgtcaaccgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgttcagaataaac
catctatgctgtttggattagtgatcatcttgaagttgcagtggtgaatttatt
back to top
>KJ575413.1-GAPDH690
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagtatatgaatgttaagatactaga
tttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactg
gagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgc
cactgcttcagtattgttgatacacttttaagttacatgtcagtgatacttcatctgtaacagctttattaatccttgat
tttggaatatctttaggctgtcggaaaggttctacctgctctcaatggcaagttgaccggaatggccttccgtgtaccca
ctgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaag
taaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatcacattacaatgcatgtcttgtttcta
atcttttatctttaataatcttttatctttaattctgtctgaacagggaggagtctgagggaaagttgaagggcatcttg
ggttacaccgatgaggatgttgtgtcaaccgacttcattggtgacaacag
back to top
>KM353448.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgttggaaaggttctacctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353447.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
tttccagcagcactggtgctgccaaggctgtcggaaaggttctacctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtccgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttca
ttggtgacaacag
back to top
>KM353446.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctacctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcctgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353445.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggtgctgccaaggctgtcggaaaggttctacctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtccgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttca
ttggtgacaacag
back to top
>KM353444.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctacctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KM353443.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagctaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttca
ttggtgacaacag
back to top
>KM353442.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagctaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaatag
back to top
>KM353441.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctacctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaaccgacttca
ttggtgacaacag
back to top
>KJ575413.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctacctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaaccgacttcattggtgacaacag
back to top