GAPDH, GAPDH (gene) Rosa virginiana

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa virginiana
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091171.1-GAPDHRosa virginianagene
GAPDHDQ091170.1-GAPDHRosa virginianagene
GAPDHDQ091169.1-GAPDHRosa virginianagene
GAPDHDQ091168.1-GAPDHRosa virginianagene
GAPDHDQ091167.1-GAPDHRosa virginianagene
GAPDHDQ091166.1-GAPDHRosa virginianagene
GAPDHDQ091165.1-GAPDHRosa virginianagene
GAPDHDQ091164.1-GAPDHRosa virginianagene
GAPDHDQ091163.1-GAPDHRosa virginianagene
GAPDHDQ091162.1-GAPDHRosa virginianagene
GAPDHDQ091161.1-GAPDHRosa virginianagene
GAPDHDQ091160.1-GAPDHRosa virginianagene
GAPDHDQ091159.1-GAPDHRosa virginianagene
GAPDHDQ091158.1-GAPDHRosa virginianagene
GAPDHDQ091157.1-GAPDHRosa virginianagene
GAPDHDQ091156.1-GAPDHRosa virginianagene
GAPDHDQ091155.1-GAPDHRosa virginianagene
GAPDHDQ091154.1-GAPDHRosa virginianagene
GAPDHDQ091153.1-GAPDHRosa virginianagene
GAPDHDQ091152.1-GAPDHRosa virginianagene
GAPDHDQ091151.1-GAPDHRosa virginianagene
GAPDHDQ091150.1-GAPDHRosa virginianagene
GAPDHDQ091149.1-GAPDHRosa virginianagene
GAPDHDQ091148.1-GAPDHRosa virginianagene
GAPDHDQ091147.1-GAPDHRosa virginianagene
GAPDHDQ091146.1-GAPDHRosa virginianagene
GAPDHDQ091145.1-GAPDHRosa virginianagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091171.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091170.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091169.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091168.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091167.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091166.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091165.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091164.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091163.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091162.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091161.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091160.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091159.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091158.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091157.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091156.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091155.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091154.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091153.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091152.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091151.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091150.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091149.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091148.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091147.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091146.1-GAPDH.m1Rosa virginianamRNA
GAPDHDQ091145.1-GAPDH.m1Rosa virginianamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa virginianagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ091171.1-GAPDH N/A DQ091171.1
gene parsed from NCBI nr database DQ091170.1-GAPDH N/A DQ091170.1
gene parsed from NCBI nr database DQ091169.1-GAPDH N/A DQ091169.1
gene parsed from NCBI nr database DQ091168.1-GAPDH N/A DQ091168.1
gene parsed from NCBI nr database DQ091167.1-GAPDH N/A DQ091167.1
gene parsed from NCBI nr database DQ091166.1-GAPDH N/A DQ091166.1
gene parsed from NCBI nr database DQ091165.1-GAPDH N/A DQ091165.1
gene parsed from NCBI nr database DQ091164.1-GAPDH N/A DQ091164.1
gene parsed from NCBI nr database DQ091163.1-GAPDH N/A DQ091163.1
gene parsed from NCBI nr database DQ091162.1-GAPDH N/A DQ091162.1
gene parsed from NCBI nr database DQ091161.1-GAPDH N/A DQ091161.1
gene parsed from NCBI nr database DQ091160.1-GAPDH N/A DQ091160.1
gene parsed from NCBI nr database DQ091159.1-GAPDH N/A DQ091159.1
gene parsed from NCBI nr database DQ091158.1-GAPDH N/A DQ091158.1
gene parsed from NCBI nr database DQ091157.1-GAPDH N/A DQ091157.1
gene parsed from NCBI nr database DQ091156.1-GAPDH N/A DQ091156.1
gene parsed from NCBI nr database DQ091155.1-GAPDH N/A DQ091155.1
gene parsed from NCBI nr database DQ091154.1-GAPDH N/A DQ091154.1
gene parsed from NCBI nr database DQ091153.1-GAPDH N/A DQ091153.1
gene parsed from NCBI nr database DQ091152.1-GAPDH N/A DQ091152.1
gene parsed from NCBI nr database DQ091151.1-GAPDH N/A DQ091151.1
gene parsed from NCBI nr database DQ091150.1-GAPDH N/A DQ091150.1
gene parsed from NCBI nr database DQ091149.1-GAPDH N/A DQ091149.1
gene parsed from NCBI nr database DQ091148.1-GAPDH N/A DQ091148.1
gene parsed from NCBI nr database DQ091147.1-GAPDH N/A DQ091147.1
gene parsed from NCBI nr database DQ091146.1-GAPDH N/A DQ091146.1
gene parsed from NCBI nr database DQ091145.1-GAPDH N/A DQ091145.1
mRNA parsed from NCBI nr database DQ091171.1-GAPDH.m1 N/A DQ091171.1
mRNA parsed from NCBI nr database DQ091170.1-GAPDH.m1 N/A DQ091170.1
mRNA parsed from NCBI nr database DQ091169.1-GAPDH.m1 N/A DQ091169.1
mRNA parsed from NCBI nr database DQ091168.1-GAPDH.m1 N/A DQ091168.1
mRNA parsed from NCBI nr database DQ091167.1-GAPDH.m1 N/A DQ091167.1
mRNA parsed from NCBI nr database DQ091166.1-GAPDH.m1 N/A DQ091166.1
mRNA parsed from NCBI nr database DQ091165.1-GAPDH.m1 N/A DQ091165.1
mRNA parsed from NCBI nr database DQ091164.1-GAPDH.m1 N/A DQ091164.1
mRNA parsed from NCBI nr database DQ091163.1-GAPDH.m1 N/A DQ091163.1
mRNA parsed from NCBI nr database DQ091162.1-GAPDH.m1 N/A DQ091162.1
mRNA parsed from NCBI nr database DQ091161.1-GAPDH.m1 N/A DQ091161.1
mRNA parsed from NCBI nr database DQ091160.1-GAPDH.m1 N/A DQ091160.1
mRNA parsed from NCBI nr database DQ091159.1-GAPDH.m1 N/A DQ091159.1
mRNA parsed from NCBI nr database DQ091158.1-GAPDH.m1 N/A DQ091158.1
mRNA parsed from NCBI nr database DQ091157.1-GAPDH.m1 N/A DQ091157.1
mRNA parsed from NCBI nr database DQ091156.1-GAPDH.m1 N/A DQ091156.1
mRNA parsed from NCBI nr database DQ091155.1-GAPDH.m1 N/A DQ091155.1
mRNA parsed from NCBI nr database DQ091154.1-GAPDH.m1 N/A DQ091154.1
mRNA parsed from NCBI nr database DQ091153.1-GAPDH.m1 N/A DQ091153.1
mRNA parsed from NCBI nr database DQ091152.1-GAPDH.m1 N/A DQ091152.1
mRNA parsed from NCBI nr database DQ091151.1-GAPDH.m1 N/A DQ091151.1
mRNA parsed from NCBI nr database DQ091150.1-GAPDH.m1 N/A DQ091150.1
mRNA parsed from NCBI nr database DQ091149.1-GAPDH.m1 N/A DQ091149.1
mRNA parsed from NCBI nr database DQ091148.1-GAPDH.m1 N/A DQ091148.1
mRNA parsed from NCBI nr database DQ091147.1-GAPDH.m1 N/A DQ091147.1
mRNA parsed from NCBI nr database DQ091146.1-GAPDH.m1 N/A DQ091146.1
mRNA parsed from NCBI nr database DQ091145.1-GAPDH.m1 N/A DQ091145.1

Sequence(s):
>DQ091171.1-GAPDH751
tggtgagttttcacttgcaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091170.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagcg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091169.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtatgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtctcggttctaatcttttgtctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091168.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091167.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagcg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091166.1-GAPDH737
tggtgagttttcacttgcaaccaatgttaagatactagatttgaaaccaactaaagtcgtctgtgtatttgcaattcagc
cacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagca
gcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacttgtaagttacatgtc
ggtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaaggttctgcctgctc
tcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgag
aagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaattagttgcaatcaag
gtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaacagggaggagtctga
gggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgacaacaggtaaatga
atattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtggtcatcttgaagtt
gcagtggtgaatttatt
back to top
>DQ091165.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagcg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091164.1-GAPDH751
tggtgagttttcacttgcaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091163.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcaggacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatatatt
back to top
>DQ091162.1-GAPDH751
tggtgagttgtcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctcccaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcgtttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagcg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091161.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagcg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091160.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcaggacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatatatt
back to top
>DQ091159.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagcg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091158.1-GAPDH751
tggtgagttttcacttgcaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091157.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcaggacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatatatt
back to top
>DQ091156.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagcg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091155.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgtcgatggaccttcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaatgaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091154.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgcctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091153.1-GAPDH751
tggtgagttttcacttgcaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091152.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcaggacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091151.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttgcatgtcagtgattcttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtgtggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091150.1-GAPDH754
cactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctc
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattgg
tgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctattctgtttggatta
gtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091149.1-GAPDH754
cactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctc
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattgg
tgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggatta
gcggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091148.1-GAPDH754
cactggtgagttttcacttgcaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctc
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattgg
tgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggatta
gtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091147.1-GAPDH754
cactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctc
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattgg
tgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctattctgtttggatta
gtggtcatcttgaagttgcagtggtgaatttttt
back to top
>DQ091146.1-GAPDH754
cactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctc
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattgg
tgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggatta
gtggtcatcttgacgttgcagtggtgaatttatt
back to top
>DQ091145.1-GAPDH754
cactggtgagttttcacttgcaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctg
tgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcatt
caacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgataca
cttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcgg
aaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacc
tcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgtt
aattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttatctttaattctgtctc
aacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattgg
tgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggatta
gtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091171.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091170.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091169.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091168.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091167.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091166.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091165.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091164.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091163.1-GAPDH.m1327
tgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091162.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctcccaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091161.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091160.1-GAPDH.m1327
tgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091159.1-GAPDH.m1327
tgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091158.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091157.1-GAPDH.m1327
tgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091156.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091155.1-GAPDH.m1327
tgccacccagaagactgtcgatggaccttcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091154.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091153.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091152.1-GAPDH.m1327
tgccacccagaagactgtcgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091151.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091150.1-GAPDH.m1330
cactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattc
ccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgt
gtacccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgc
tatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattg
gtgacaacag
back to top
>DQ091149.1-GAPDH.m1330
cactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattc
ccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgt
gtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgc
tatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattg
gtgacaacag
back to top
>DQ091148.1-GAPDH.m1330
cactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattc
ccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgt
gtacccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgc
tatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattg
gtgacaacag
back to top
>DQ091147.1-GAPDH.m1330
cactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattc
ccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgt
gtacccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgc
tatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattg
gtgacaacag
back to top
>DQ091146.1-GAPDH.m1330
cactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattc
ccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgt
gtacccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgc
tatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattg
gtgacaacag
back to top
>DQ091145.1-GAPDH.m1330
cactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattc
ccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgt
gtacccactgttgatgtttcagttgttgacctcactgttagacttgagaagaaggcaacctatgaccagatcaaggctgc
tatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattg
gtgacaacag
back to top