GAPDH, GAPDH (gene) Rosa woodsii

Gene Overview
Name GAPDH
Gene Symbol GAPDH
Type gene
Organism Rosa woodsii
Synonym glyceraldehyde 3-phosphate dehydrogenase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091085.1-GAPDHRosa woodsiigene
GAPDHDQ091084.1-GAPDHRosa woodsiigene
GAPDHDQ091083.1-GAPDHRosa woodsiigene
GAPDHDQ091082.1-GAPDHRosa woodsiigene
GAPDHDQ091081.1-GAPDHRosa woodsiigene
GAPDHDQ091080.1-GAPDHRosa woodsiigene
GAPDHDQ091079.1-GAPDHRosa woodsiigene
GAPDHDQ091078.1-GAPDHRosa woodsiigene
GAPDHDQ091077.1-GAPDHRosa woodsiigene
GAPDHDQ091076.1-GAPDHRosa woodsiigene
GAPDHDQ091075.1-GAPDHRosa woodsiigene
GAPDHDQ091074.1-GAPDHRosa woodsiigene
GAPDHEU315086.1-GAPDHRosa woodsiigene
GAPDHEU315085.1-GAPDHRosa woodsiigene
GAPDHEU315084.1-GAPDHRosa woodsiigene
GAPDHEU315083.1-GAPDHRosa woodsiigene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GAPDHDQ091085.1-GAPDH.m1Rosa woodsiimRNA
GAPDHDQ091084.1-GAPDH.m1Rosa woodsiimRNA
GAPDHDQ091083.1-GAPDH.m1Rosa woodsiimRNA
GAPDHDQ091082.1-GAPDH.m1Rosa woodsiimRNA
GAPDHDQ091081.1-GAPDH.m1Rosa woodsiimRNA
GAPDHDQ091080.1-GAPDH.m1Rosa woodsiimRNA
GAPDHDQ091079.1-GAPDH.m1Rosa woodsiimRNA
GAPDHDQ091078.1-GAPDH.m1Rosa woodsiimRNA
GAPDHDQ091077.1-GAPDH.m1Rosa woodsiimRNA
GAPDHDQ091076.1-GAPDH.m1Rosa woodsiimRNA
GAPDHDQ091075.1-GAPDH.m1Rosa woodsiimRNA
GAPDHDQ091074.1-GAPDH.m1Rosa woodsiimRNA
GAPDHEU315086.1-GAPDH.m1Rosa woodsiimRNA
GAPDHEU315085.1-GAPDH.m1Rosa woodsiimRNA
GAPDHEU315084.1-GAPDH.m1Rosa woodsiimRNA
GAPDHEU315083.1-GAPDH.m1Rosa woodsiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
glyceraldehyde 3-phosphate dehydrogenaseGAPDHRosa woodsiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ091085.1-GAPDH N/A DQ091085.1
gene parsed from NCBI nr database DQ091084.1-GAPDH N/A DQ091084.1
gene parsed from NCBI nr database DQ091083.1-GAPDH N/A DQ091083.1
gene parsed from NCBI nr database DQ091082.1-GAPDH N/A DQ091082.1
gene parsed from NCBI nr database DQ091081.1-GAPDH N/A DQ091081.1
gene parsed from NCBI nr database DQ091080.1-GAPDH N/A DQ091080.1
gene parsed from NCBI nr database DQ091079.1-GAPDH N/A DQ091079.1
gene parsed from NCBI nr database DQ091078.1-GAPDH N/A DQ091078.1
gene parsed from NCBI nr database DQ091077.1-GAPDH N/A DQ091077.1
gene parsed from NCBI nr database DQ091076.1-GAPDH N/A DQ091076.1
gene parsed from NCBI nr database DQ091075.1-GAPDH N/A DQ091075.1
gene parsed from NCBI nr database DQ091074.1-GAPDH N/A DQ091074.1
gene parsed from NCBI nr database EU315086.1-GAPDH N/A EU315086.1
gene parsed from NCBI nr database EU315085.1-GAPDH N/A EU315085.1
gene parsed from NCBI nr database EU315084.1-GAPDH N/A EU315084.1
gene parsed from NCBI nr database EU315083.1-GAPDH N/A EU315083.1
mRNA parsed from NCBI nr database DQ091085.1-GAPDH.m1 N/A DQ091085.1
mRNA parsed from NCBI nr database DQ091084.1-GAPDH.m1 N/A DQ091084.1
mRNA parsed from NCBI nr database DQ091083.1-GAPDH.m1 N/A DQ091083.1
mRNA parsed from NCBI nr database DQ091082.1-GAPDH.m1 N/A DQ091082.1
mRNA parsed from NCBI nr database DQ091081.1-GAPDH.m1 N/A DQ091081.1
mRNA parsed from NCBI nr database DQ091080.1-GAPDH.m1 N/A DQ091080.1
mRNA parsed from NCBI nr database DQ091079.1-GAPDH.m1 N/A DQ091079.1
mRNA parsed from NCBI nr database DQ091078.1-GAPDH.m1 N/A DQ091078.1
mRNA parsed from NCBI nr database DQ091077.1-GAPDH.m1 N/A DQ091077.1
mRNA parsed from NCBI nr database DQ091076.1-GAPDH.m1 N/A DQ091076.1
mRNA parsed from NCBI nr database DQ091075.1-GAPDH.m1 N/A DQ091075.1
mRNA parsed from NCBI nr database DQ091074.1-GAPDH.m1 N/A DQ091074.1
mRNA parsed from NCBI nr database EU315086.1-GAPDH.m1 N/A EU315086.1
mRNA parsed from NCBI nr database EU315085.1-GAPDH.m1 N/A EU315085.1
mRNA parsed from NCBI nr database EU315084.1-GAPDH.m1 N/A EU315084.1
mRNA parsed from NCBI nr database EU315083.1-GAPDH.m1 N/A EU315083.1

Sequence(s):
>DQ091085.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtatgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtctcggttct
aatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091084.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtatgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091083.1-GAPDH749
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagttgtatgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatggttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatgaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttgtctttaattctgtctcaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgaca
acaggtaaatgaatatttgtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattactggt
catcttgaagttgcagtggtgaatttatt
back to top
>DQ091082.1-GAPDH751
tggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgt
atttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaa
catcattcccagcagcacaggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacactt
gtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaa
ggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctca
ctgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaat
tagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgtctcaac
agggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtga
caacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtg
gtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091081.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtatgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091080.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtatgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtctcggttct
aatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091079.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtatgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaaccttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091078.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtatgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091077.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
ctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgt
ctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091076.1-GAPDH757
catcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgt
atgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctc
attcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgat
acacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgt
cggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttg
acctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgtt
gttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgt
ctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcat
tggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttgga
ttagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>DQ091075.1-GAPDH773
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtatgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtctcggttct
aatcttttgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaa
back to top
>DQ091074.1-GAPDH779
gtcttatgactaccgtgcactccatcactggtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactag
atttgaaaccaactaaagtcgtctgtgtatttgcaattcagccacccagaagactgttgatggaccatcagcaaaggact
ggagaggtggacgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggtattttcaatattctttgtg
ccactgcttcagtattgttgatacacttgtaagttacatgtcagtgatacttcatctttaacagctttattaatccttga
ttttggaatatgtttaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtaccc
actgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaa
gtaaggcttgttgaactttgttgttaattagttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttct
aatctttcgtctttaattctgtctcaacagggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgagg
atgttgtgtcaactgacttcattggtgacaacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaa
taaaccatctatgctgtttggattagtggtcatcttgaagttgcagtggtgaatttatt
back to top
>EU315086.1-GAPDH749
gtgagtttttacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtatgtgtat
ttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaaca
tcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacttgt
aagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcact
gtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaatta
gttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgtctcaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgaca
acaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtggt
catcttgaagttgcagtggtgaatttatt
back to top
>EU315085.1-GAPDH750
gtgagtttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtctgtgta
tttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaac
atcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacttg
taagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaag
gttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcac
tgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaatt
agttgcaatcaaggtggggtgtcatgacattacaatgtatgtcttggttctaatcttttatctttaaatctgtctcaaca
gggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgac
aacaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtgg
tcatcttgaagttgcagtggtgaatttatt
back to top
>EU315084.1-GAPDH749
gtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtatgtgtat
ttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaaca
tcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacttgt
aagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcact
gtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaatta
gttgcaatcaaggtggggtgtcatgacattacaatgcatgtcttggttctaatcttttgtctttaattctgtctcaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgaca
acaggtaaatgaatattagtcatttaatggttggagtactacgtacagaataaaccatctatgctgtttggattagtggt
catcttgaagttgcagtggtgaatttatt
back to top
>EU315083.1-GAPDH749
gtgagttttcacttgtaaccatgtgagatatatgaatgttaagatactagatttgaaaccaactaaagtcgtatgtgtat
ttgcaattcagccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaaca
tcattcccagcagcactggagctgccaaggtattttcaatattctttgtgccactgcttcagtattgttgatacacttgt
aagttacatgtcagtgatacttcatctttaacagctttattaatccttgattttggaatatgtttaggctgtcggaaagg
ttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcact
gtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatcaagtaaggcttgttgaactttgttgttaatta
gttgcaatcaaggtggggtgtcatgacattacaatgtatgtcttggttctaatcttttatctttaaatctgtctcaacag
ggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgaca
acaggtaaatgaatattagtcatttaatggttggagtaccacgtacagaataaaccatctatgctgttcggattagtggt
catcttgaagttgcagtggtgaatttatt
back to top
>DQ091085.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091084.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091083.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091082.1-GAPDH.m1327
tgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattccca
gcagcacaggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgta
cccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctat
caaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtg
acaacag
back to top
>DQ091081.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091080.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091079.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091078.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091077.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttca
ttggtgacaacag
back to top
>DQ091076.1-GAPDH.m1333
catcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatca
ttcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttc
cgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggc
tgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttca
ttggtgacaacag
back to top
>DQ091075.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>DQ091074.1-GAPDH.m1355
gtcttatgactaccgtgcactccatcactgccacccagaagactgttgatggaccatcagcaaaggactggagaggtgga
cgtgctgcctcattcaacatcattcccagcagcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatgg
caagttgaccggaatggccttccgtgtacccactgttgatgtttcagttgttgacctcactgtcagacttgagaagaagg
caacctatgaccagatcaaggctgctatcaaggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgag
gatgttgtgtcaactgacttcattggtgacaacag
back to top
>EU315086.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgac
aacag
back to top
>EU315085.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgac
aacag
back to top
>EU315084.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgac
aacag
back to top
>EU315083.1-GAPDH.m1325
ccacccagaagactgttgatggaccatcagcaaaggactggagaggtggacgtgctgcctcattcaacatcattcccagc
agcactggagctgccaaggctgtcggaaaggttctgcctgctctcaatggcaagttgaccggaatggccttccgtgtacc
cactgttgatgtttcagttgttgacctcactgtcagacttgagaagaaggcaacctatgaccagatcaaggctgctatca
aggaggagtctgagggaaagttgaagggcatcttgggttacaccgatgaggatgttgtgtcaactgacttcattggtgac
aacag
back to top