GLU2, GLU2 (gene) Malus x domestica

Gene Overview
Name GLU2
Gene Symbol GLU2
Type gene
Organism Malus x domestica
Synonym beta-1,3-glucanase
GLU-2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GLU2AF494405.1-GLU2.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
beta-1,3-glucanaseGLUMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AF494405.1-GLU2.m1 Chr14:9119542..9119862
Chr14:9156297..9156617
Chr14:9141796..9142116
chr14:12294838..12295158
chr14:12373143..12373463
chr14:12373226..12373546
chr14:12363437..12363757
chr14:14870571..14870891
AF494405.1

Sequence(s):
>AF494405.1-GLU2.m1320
tatgctcttttcacagctccgtcagttgtagtacaagatggccaacgtggttatcgtaatcttttcgatgccattttgga
tgctgtttatgctgcgcttgacaaggtcggtggaggatcgttggaaattgttgtatcggagagtggttggccgacagctg
gtgggacggcaacaacagttgataatgcgaggacttataactcgaatttgattcaacatgtgaagggagggactccaagg
aagcctggaaggcccattgaaacttacatctttgccatgtctgatgagaatagaaagaccccagagcttgagaaacattg
back to top