GLU, GLU (gene) Fragaria x ananassa

Gene Overview
Name GLU
Gene Symbol GLU
Type gene
Organism Fragaria x ananassa
Synonym beta-1,3-glucanase
BG2-3
BG2-1
BG2-2
Description NA
Comment FaBG2-1
FaBG2-2
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GLUAY170375.1-GLUFragaria x ananassagene
GLUAY989818.1-GLUFragaria x ananassagene
GLUAB106362.1-GLUFragaria x ananassagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GLUAY170376.1-GLU.m1Fragaria x ananassamRNA
GLUAY170375.1-GLU.m1Fragaria x ananassamRNA
GLUAY989819.1-GLU.m1Fragaria x ananassamRNA
GLUAY989818.1-GLU.m1Fragaria x ananassamRNA
GLUAB106653.1-GLU.m1Fragaria x ananassamRNA
GLUAB106652.1-GLU.m1Fragaria x ananassamRNA
GLUAB106651.1-GLU.m1Fragaria x ananassamRNA
GLUAB106362.1-GLU.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
beta-1,3-glucanaseGLUFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY170375.1-GLU N/A AY170375.1
gene parsed from NCBI nr database AY989818.1-GLU N/A AY989818.1
gene parsed from NCBI nr database AB106362.1-GLU LG2:23803346..23804759
AB106362.1
mRNA parsed from NCBI nr database AY170376.1-GLU.m1 N/A AY170376.1
mRNA parsed from NCBI nr database AY170375.1-GLU.m1 N/A AY170375.1
mRNA parsed from NCBI nr database AY989819.1-GLU.m1 N/A AY989819.1
mRNA parsed from NCBI nr database AY989818.1-GLU.m1 N/A AY989818.1
mRNA parsed from NCBI nr database AB106653.1-GLU.m1 LG2:23803346..23804759
AB106653.1
mRNA parsed from NCBI nr database AB106652.1-GLU.m1 LG2:23803346..23804759
AB106652.1
mRNA parsed from NCBI nr database AB106651.1-GLU.m1 LG2:23803346..23804759
AB106651.1
mRNA parsed from NCBI nr database AB106362.1-GLU.m1 LG2:23803346..23804759
AB106362.1

Sequence(s):
>AY170375.1-GLU1495
gtagcaagagtaaacacatacagatcagtttgttagtattgtttcctcttcctcatggatttttcctacacaacacttaa
aaataccttcatggctcccatattgctgctccttgttctgtttatgcctgctctacagataacaggtctgtctttctctt
ttcgatcttgtattgcatcagacaatggttttgatggatagtgtaacaaacagagtagatattttatagttatgagactt
tctgtaactatatcataattgcatgtagccattgttatctcttttaaccatgttaccaaattaagcagagatttgtggtt
tattaagcaaatatgttccactagatggtatgcaggtgattagaacaattctacaaagaaaaatgtgtatgatctgcttc
ctgtgtctctttctaacgtgatgccaaggaacatttcataatgtcttgaactcttgaaactcttttcatacatagttttt
catcagctgatgggtctcagagtgatttgctcctcatcagttttgttacatgattatttcaggcgcacaatctgcgggtg
tctgctatggacgaaatggcaacaatttaccttctgatacagaagttgttgatttgtacaaaagcaatggaattggaagg
atgaggatttatgagccaaaccaagcaaccttggaagcccttagaggttccaacatagaactcatggtcaccatcctcaa
caacaacctgcaagcgcttactgatgctgcagcagctacagattgggtccagaaaaatgtgcaaccctactcggctgatg
tcaagttcaagtacattgccgttggaaatgaagtacaccctgatgctgcagaagctaaatatcttcttcctgccatacag
aatattcagaatgcggtaacagccgctaatctacaaggccaaatcaaagtgtcaacagcaatagatacaacatttttacc
ccctgactttgtccttccttcaaatggggcattcagcgatgctgcaaattcattcattaccccaattatcacctttttga
gcaacaatggagcaccacttcttgtcaatatatacccctacttcgcctatattggtgacccagttaacataaaactagaa
tatgccttgttcacttcaccaggggtagaactacaggatggtagtaatgggtaccagaacatctttgatgctctcttgga
cactcattactctgctcttgaaaaagcaggggctcccaatatggcgatagttgtatccgagagtggttggccatctgaag
gtggtgatgctgcaactactggtaatgcaggaacttactacagcaaattgatcaatcatgtgaagaccgggactccaaag
agaccaaatggagctattgaaacttatctgtttgccatgtttgatgaaaacctgaaggatggtgcagaagttgagaaaca
ttttggtatcttctcccctaacaaacagcccaagtaccaactcacctttggctag
back to top
>AY989818.1-GLU963
atgcttatttcaggtgcacaatctgcgggtgtctgctatggacgaaacggtgacaatttaccttctgatacagaagtcgt
tgatttgtacaaaagcaatggaattggaaggatgaggatttatgagccaaaccaagcaaccttggaagcccttagaggtt
ccaacatagaactcatggtcaccatcctcaacaacaacctgcaagcgcttactgatgctgcagcagctacagattgggtc
cagaaaaatgtgcaaccctactcggctgatgtcaagttcaaatacattgccgttggaaatgaagtacaccctgatgctgc
tgaagctcaatatcttcttcctgccatacagaatattcagaatgcggtaacagccgctaatctacaaggccaaatcaaag
tgtcaacagcagtagatacaactcttttggaccctagcttccctccttcagacggggcattcagcagtgctgcgaattca
ttcattaccccaataatcacctttttgggcaacaatggagcaccacttcttgtcaatatatacccctacttcgcctatat
tggtgaccctgctaacataaaactagaatatgccttgttcacttcaccaggggtagtagtacaggatggtagtaatgggt
accagaacatctttgatgctattttggacactcattactctgctcttgaaaaagcaggggcttccaatatggcgatagtt
gtatccgagggtggttggccatctgaaggtagtgatgctgcaactaatggtaatgcaggaacttactacagcaatttgat
caatcatgtgaagaccgggactcccaagagaccaaatggagctatcgaaacttacctgtttgccatgtttgatgaaaacc
tcaaggacggtgcagaaattgagaatcattttggcatcttctcccctaacaaacagcccaagtaccaactcacctttggc
tag
back to top
>AB106362.1-GLU1413
atgtatttttcctacacaacacttaaaaataccttcatggctcccatattgctgctccttgttctgtttatgccggctct
acagataacaggtctgtctttctcttttcgatcttgtattgcatcagacaatggttttgatggatatagtgtaacatatg
gcatagggaatattcagtagttatgagattttccataactatatcataattgcatgtagccattgttatctcttataacc
atgttaccaaattaagcagagatttgtggtttgttaagtatttatgttccactagatggtatgcgggtgatttgaacact
tcctttgtctctttctaacgtgatgccaaggaacttttcatactgtcttgcactcttgaactcttttcatacatagtttt
tcatcaactgatgagtctcagagtgattttctactcatcagttctgttacatgcttatttcaggtggacaatctgcgggt
gtctgctatggacgaaacggcgacaatttaccttctgatacagaggttattgatttgtacaaaagcaatggaattggaag
gatgaggatttatgagccaaaccaagcaaccttggaagcccttagaggttccaacatagaactcatggtcaccatcctca
acaacaacctgcaagcgcttactgatgctgcagcagctacagattgggtccagaaaaatgtgcaaccctactcggctgac
gtcaagttcaagtacattgccgttggaaatgaagtacaccctgatgctgcagaagctcaatatcttctgcctgccataca
aaatattcagaatgcagtaaaagccgctaatctacaaggccaaatcaaagtgtcaacagcaatagatacaacccttttgg
accctagcttccctccttcagacggggcattcagcagtgctgcgaattcattcattaccccaataatcacctttttgggc
aacaatggagcaccacttcttgtcaatatatacccctacttcgcctatattggtgaccctgctaacataaaactagaata
tgccttgttcacttcaccaggggtagtagtacaggatggtagtaatgggtaccagaacatctttgatgctatcttggaca
ctcattactctgctcttgaaaaagcaggggctcccaatatggtgatagttgtatccgagagtggttggccatctgaaggt
agtgatgctgcaactaatggtaatgcaggaacttactacagcaatttgatcaatcatgtgaagaccgggactccgaagag
accaaatggagctatcgaaacttacctgtttgccatgtttgatgaaaacttgaaggatggtgcagaagttgagaaacatt
ttggtatcttctcccctaacaaacagcccaagtaccaactcacctttggctag
back to top
>AY170376.1-GLU.m1414
atggatttttcctacacaacacttaaaaataccttcatggctcccatattgctgccccttgttctgtttatgcccgctct
acagataacaggcgcacaatctgcgggtgtctgctatggacgaaatggcaacaatttaccttctgatacagaagttgccg
atttgtacaaaagcaatggaattggaaggatgaggatttatgagccaaaccaagcaaccttggaagcccttagaggttcc
aacatagaactcatggtcaccatcctcaacaacaacctgcaagcgcttactgatgctgcagcagctacagattgggtcca
gaaaaatgtgcaaccctactcggctgatgtcaagttcaagtacattgccgttggaaatgaagtacaccctgatgctgcag
aagctaaatatctt
back to top
>AY170375.1-GLU.m11044
atggatttttcctacacaacacttaaaaataccttcatggctcccatattgctgctccttgttctgtttatgcctgctct
acagataacaggcgcacaatctgcgggtgtctgctatggacgaaatggcaacaatttaccttctgatacagaagttgttg
atttgtacaaaagcaatggaattggaaggatgaggatttatgagccaaaccaagcaaccttggaagcccttagaggttcc
aacatagaactcatggtcaccatcctcaacaacaacctgcaagcgcttactgatgctgcagcagctacagattgggtcca
gaaaaatgtgcaaccctactcggctgatgtcaagttcaagtacattgccgttggaaatgaagtacaccctgatgctgcag
aagctaaatatcttcttcctgccatacagaatattcagaatgcggtaacagccgctaatctacaaggccaaatcaaagtg
tcaacagcaatagatacaacatttttaccccctgactttgtccttccttcaaatggggcattcagcgatgctgcaaattc
attcattaccccaattatcacctttttgagcaacaatggagcaccacttcttgtcaatatatacccctacttcgcctata
ttggtgacccagttaacataaaactagaatatgccttgttcacttcaccaggggtagaactacaggatggtagtaatggg
taccagaacatctttgatgctctcttggacactcattactctgctcttgaaaaagcaggggctcccaatatggcgatagt
tgtatccgagagtggttggccatctgaaggtggtgatgctgcaactactggtaatgcaggaacttactacagcaaattga
tcaatcatgtgaagaccgggactccaaagagaccaaatggagctattgaaacttatctgtttgccatgtttgatgaaaac
ctgaaggatggtgcagaagttgagaaacattttggtatcttctcccctaacaaacagcccaagtaccaactcacctttgg
ctag
back to top
>AY989819.1-GLU.m11041
atggatttttcgtacgcaacacttaaaaataccttcatggctcccatattgctgctccttgttctgtttatgcctgctct
acagataacaggtgcacaatctgcgggtgtctgctatggacgaaacggtgacaatttaccttctgatacagaagtcgttg
atttgtacaaaagcaatggaattggaaggatgaggatttatgagccaaaccaagcaaccttagaagcccttagaggttcc
aacatagaactcatggtcaccatcctcaacaacaacctgcaagcgcttactgatgctgcagcagctacagattgggtcca
gaaaaatgtgcaaccctactcggctgatgtcaagttcaaatacattgccgttggaaatgaagtacaccctggtgctgcag
aagctcaatatctacttcctgccatacagaatattcagaatgcggtaacagccgctaatctacaaggccaaatcaaagtg
tcaacagcaatagatacaactcttttggaccctagcttccctccttcagacggggcattcagcagtgctgcgaattcatt
cattaccccaataatcacctttttgggcaacaatggagcaccacttcttgtcaatatatacccctacttcgcctatattg
gtgaccctgctaacataaaactagaatatgccttgttcacttcaccaggggtagtagtacaggatggtagtaatgggtac
cagaacatctttgatgctattttggacactcattactctgctcttgaaaaagcaggggcttccaatatggcgatagttgt
atccgagagtggttggccatctgaaggtagtgatgctgcaactaatggtaatgcaggaacttactacagcaatttgatca
gtcatgtgaagaccgggactccgaagagaccaaatggagctatcgaaacttatctgtttgccatgtttgatgaaaacctc
aaggacggtgcagaaattgagaaacattttggtatcttctcccctaacaaacagcccaagtaccaactcacctttggcta
g
back to top
>AY989818.1-GLU.m1963
atgcttatttcaggtgcacaatctgcgggtgtctgctatggacgaaacggtgacaatttaccttctgatacagaagtcgt
tgatttgtacaaaagcaatggaattggaaggatgaggatttatgagccaaaccaagcaaccttggaagcccttagaggtt
ccaacatagaactcatggtcaccatcctcaacaacaacctgcaagcgcttactgatgctgcagcagctacagattgggtc
cagaaaaatgtgcaaccctactcggctgatgtcaagttcaaatacattgccgttggaaatgaagtacaccctgatgctgc
tgaagctcaatatcttcttcctgccatacagaatattcagaatgcggtaacagccgctaatctacaaggccaaatcaaag
tgtcaacagcagtagatacaactcttttggaccctagcttccctccttcagacggggcattcagcagtgctgcgaattca
ttcattaccccaataatcacctttttgggcaacaatggagcaccacttcttgtcaatatatacccctacttcgcctatat
tggtgaccctgctaacataaaactagaatatgccttgttcacttcaccaggggtagtagtacaggatggtagtaatgggt
accagaacatctttgatgctattttggacactcattactctgctcttgaaaaagcaggggcttccaatatggcgatagtt
gtatccgagggtggttggccatctgaaggtagtgatgctgcaactaatggtaatgcaggaacttactacagcaatttgat
caatcatgtgaagaccgggactcccaagagaccaaatggagctatcgaaacttacctgtttgccatgtttgatgaaaacc
tcaaggacggtgcagaaattgagaatcattttggcatcttctcccctaacaaacagcccaagtaccaactcacctttggc
tag
back to top
>AB106653.1-GLU.m11041
atgtatttttcctacacaactcttaaaaataccttcatgactcccatattgctgctccttgttctgtttatgccggctct
acagataacaggtggacaatctgcgggtgtctgctatggacgaaacggcgacaatttaccttctgatacagaggttattg
atttgtacaaaagcaatggaattggaaggatgaggatttatgagccaaaccaagcaaccttggaagcccttagaggttcc
aacatagaactcatggtcaccatcctcaacaacaacctgcaagcgcttactgatgctgcagcagctacagattgggtcca
gaaaaatgtgcaaccctactcggctgacgtcaagttcaagtacattgccgttggaaatgaagtacaccctgatgctgcag
aagctcaatatcttctgcctgccatacaaaatattcagaatgcagtaaaagccgctaatctacaaagccaaatcaaagtg
tcaacagcaatagatacaacccttttggaccctagcttccctccttcagacggggcattcagcagtgctgcgaattcatt
cattaccccaataatcacctttttgggcaacaatggagcaccacttcttgtcaatatatacccctacttcgcctatattg
gtgaccctgctaacataaaactagaatatgccttgttcacttcaccaggggtagtagtacaggatggtagtaatgggtac
cagaacatctttgatgctatcttggacactcattactctgctcttgaaaaagcaggggctcccaatatggtgatagttgt
atccgagagtggttggccatctgaaggtagtgatgctgcaactaatggtaatgcaggaacttactacagcaatttgatca
atcatgtgaagaccgggactccgaagagaccaaatggagctatcgaaacttacctgtttgccatgtttgatgaaaacttg
aaggatggtgcagaagttgagaaacattttggtatcttctcccctaacaaacagcccaagtaccaactcacctttggcta
g
back to top
>AB106652.1-GLU.m11041
atgtatttttcctacacaactcttaaaaataccttcatggctcccatattgctgctccttgttctgtttatgccggctct
acagataacaggtggacaatctgcgggtgtctgctatggacgaaacggcgacaatttaccttctgatacagaggttattg
atttgtacaaaagcaatggaattggaaggatgaggatttatgagccaaaccaagcaaccttggaagcccttagaggttcc
aacatagaactcatggtcaccatcctcaacaacaacctgcaagcgcttactgatgctgcagcagctacagattgggtcca
gaaaaatgtgcaaccctactcggctgacgtcaagttcaagtacattgccgttggaaatgaagtacaccctgatgctgcag
aagctcaatatcttctgcctgccatacaaaatattcagaatgcagtaaaagccgctaatctacaaagccaaatcaaagtg
tcaacagcaatagatacaacccttttggaccctagcttccctccttcagacggggcattcagcagtgctgcgaattcatt
cattaccccaataatcacctttttgggcaacaatggagcaccacttcttgtcaatatatacccctacttcgcctatattg
gtgaccctgctaacataaaactagaatatgccttgttcacttcaccaggggtagtagtacaggatggtagtaatgggtac
cagaacatctttgatgctatcttggacactcattactctgctcttgaaaaagcaggggctcccaatatggtgatagttgt
atccgagagtggttggccatctgaaggtagtgatgctgcaactaatggtaatgcaggaacttactacagcaatttgatca
atcatgtgaagaccgggactccgaagagaccaaatggagctatcgaaacttacctgtttgccatgtttgatgaaaacttg
aaggatggtgcagaagttgagaaacattttggtatcttctcccctaacaaacagcccaagtaccaactcacctttggcta
g
back to top
>AB106651.1-GLU.m11041
atgtatttttcctacacaacacttaaaaataccttcatggctcccatattgctgctccttgttctgtttatgccggctct
acagataacaggtggacaatctgcgggtgtctgctatggacgaaacggcgacaatttaccttctgatacagaggttattg
atttgtacaaaagcaatggaattggaaggatgaggatttatgagccaaaccaagcaaccttggaagcccttagaggttcc
aacatagaactcatggtcaccatcctcaacaacaacctgcaagcgcttactgatgctgcagcagctacagattgggtcca
gaaaaatgtgcaaccctactcggctgacgtcaagttcaagtacattgccgttggaaatgaagtacaccctgatgctgcag
aagctcaatatcttctgcctgccatacaaaatattcagaatgcagtaaaagccgctaatctacaaggccaaatcaaagtg
tcaacagcaatagatacaacccttttggaccctagcttccctccttcagacggggcattcagcagtgctgcgaattcatt
cattaccccaataatcacctttttgggcaacaatggagcaccacttcttgtcaatatatacccctacttcgcctatattg
gtgaccctgctaacataaaactagaatatgccttgttcacttcaccaggggtagtagtacaggatggtagtaatgggtac
cagaacatctttgatgctatcttggacactcattactctgctcttgaaaaagcaggggctcccaatatggtgatagttgt
atccgagagtggttggccatctgaaggtagtgatgctgcaactaatggtaatgcaggaacttactacagcaatttgatca
atcatgtgaagaccgggactccgaagagaccaaatggagctatcgaaacttacctgtttgccatgtttgatgaaaacttg
aaggatggtgcagaagttgagaaacattttggtatcttctcccctaacaaacagcccaagtaccaactcacctttggcta
g
back to top
>AB106362.1-GLU.m11041
atgtatttttcctacacaacacttaaaaataccttcatggctcccatattgctgctccttgttctgtttatgccggctct
acagataacaggtggacaatctgcgggtgtctgctatggacgaaacggcgacaatttaccttctgatacagaggttattg
atttgtacaaaagcaatggaattggaaggatgaggatttatgagccaaaccaagcaaccttggaagcccttagaggttcc
aacatagaactcatggtcaccatcctcaacaacaacctgcaagcgcttactgatgctgcagcagctacagattgggtcca
gaaaaatgtgcaaccctactcggctgacgtcaagttcaagtacattgccgttggaaatgaagtacaccctgatgctgcag
aagctcaatatcttctgcctgccatacaaaatattcagaatgcagtaaaagccgctaatctacaaggccaaatcaaagtg
tcaacagcaatagatacaacccttttggaccctagcttccctccttcagacggggcattcagcagtgctgcgaattcatt
cattaccccaataatcacctttttgggcaacaatggagcaccacttcttgtcaatatatacccctacttcgcctatattg
gtgaccctgctaacataaaactagaatatgccttgttcacttcaccaggggtagtagtacaggatggtagtaatgggtac
cagaacatctttgatgctatcttggacactcattactctgctcttgaaaaagcaggggctcccaatatggtgatagttgt
atccgagagtggttggccatctgaaggtagtgatgctgcaactaatggtaatgcaggaacttactacagcaatttgatca
atcatgtgaagaccgggactccgaagagaccaaatggagctatcgaaacttacctgtttgccatgtttgatgaaaacttg
aaggatggtgcagaagttgagaaacattttggtatcttctcccctaacaaacagcccaagtaccaactcacctttggcta
g
back to top