GLU, GLU (gene) Malus hupehensis

Gene Overview
Name GLU
Gene Symbol GLU
Type gene
Organism Malus hupehensis
Synonym beta-1,3-glucanase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GLUFJ598140.1-GLU.m1Malus hupehensismRNA
GLUGU367594.1-GLU.m1Malus hupehensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
beta-1,3-glucanaseGLUMalus hupehensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly FJ598140.1-GLU.m1 Chr14:9118684..9119914
Chr14:9140948..9142168
Chr14:9155449..9156669
chr14:12293980..12295180
chr14:12372295..12373515
chr14:12372368..12373598
chr14:12363385..12364605
chr14:14869713..14870913
FJ598140.1
predicted genes from whole genome assembly GU367594.1-GLU.m1 Chr14:9140938..9142491
Chr14:9016438..9120236
Chr14:9155439..9156989
chr14:12293990..12295180
chr14:12372285..12373836
chr14:12372368..12373918
chr14:12363065..12364615
chr14:14769350..14870913
GU367594.1

Sequence(s):
>FJ598140.1-GLU.m11041
atggcgaaaccaagttcatcagttggtagagccagaggcccttctgtgatttccataatacttgttcttggacagctgat
ggccagcttcgaaacaacaggcgcccaaattggtgtatgttatggaatgaatggagacttaccaccccaagcagaagtta
ttgctctctacaagcaaaaaaacatccgaagaatgcgactatatgatccgagcccagcagctctagcagccctcagaggc
tctgacactgagctcatgttaggcataccaaacgatcaacttcaaaacattgcttcaagccaagccaatgcaaatacatg
ggtccaaaacaatgtcagaaactatgccaatgtaagattcaaatacattgccgtaggaaacgaaatcaagccctcggact
cgtctgcgcaatttctggtcccggccatgcggaacattcaaaatgcgatttccagtgccggtcttggaaaccaaatcaaa
gtttccaccgccatagacaccggtgtgcttggaaattcctttcctccatcaaaaggagaatttaggggtgactatagccc
aattttgaatcctgttgtccggttcctggtggacaacaaatctccgctacttgttaatttgtatccttattttagttata
ttggcaacactcgtgacattcgtctagactatgctcttttcacagctcagtcagttgtagtacaagatggcgaacgtggt
tatcgtaatcttttcgatgccattttgggtgctgtttacgctgcgcttgacaaggtcggtggaggatctttggaaattgt
tgtatcggagagtggttggccgacagctggtgggacggcaacaacagttgataatgcgaggacttataactcgaatttgg
ttcaacatgtgaagggagggactccaaggaagcctggaaggcccattgaaacttacatctttgccatgtttgatgagaat
agaaagaccccagagcttgagaaacattgggggctattctcccctaacaaacagcctaaatacccaatcaatttcaacta
a
back to top
>GU367594.1-GLU.m11041
atggctaaatcaagttcatcagttggtagagccagaggcccttctgtgatttccataatacttgttcttgggcagctgat
ggccagcttcgaaacaacaggcgcccaaattggtgtatgttatggaatgaatggagacttaccaccccaagcagaagtta
ttgctctctacaagcaaaaaaacatccgaagaatgcgactatatgatccgaacccagcagctctagcagccctcagaggc
tctgacattgagctcatgttaggcctaccaaacgatcaacttcaaaacattgcttcaagccaagccaatgcaaatacatg
ggtccaaaacaatgtcagaaactatgccaatgtaagattcaaatacattgccgtaggaaacgaaatcaagccctcggact
cgtctgcgcaatttctggtcccggccatgcggaacattcaaaatgcgatttccagtgccggtcttggaaaccaaatcaaa
gtttccaccgccatagacaccggtgtgcttggaaattcctttcctccatcaaaaggagaatttaggggtgactatagccc
aattttgaatcctgttgtccggttcctggtggacaacaaatctccgctactggataatatgtatccttattttagttata
ttggcaacactcgtgacattcgtctagattatgctcttttcacagctacgtcagttgtagtacaagatggccaatttggt
tatcgtaatcttttcgatgccattttggatgctgtttacgctgcgcttgacaagatcggtggaggatctttggaaattgt
tatatcggagagtggttggccgacagctggtgggacggcaacaacagttgataatgcgaggacttataactcgaatttgg
ttcaacatgtgaagggagggactccaaggaagcctggaaggcccattgaaacttacatctttgccatgtttgatgagaat
agaaagaccccagagcttgagaaacattgggggctattctcccctaacaaacagcctaaatacccaatcaattttaacta
a
back to top