GLU, GLU (gene) Prunus persica

Gene Overview
Name GLU
Gene Symbol GLU
Type gene
Organism Prunus persica
Synonym beta-1,3-glucanase
Gns1
Gns2
Gns3
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GLUU49454.1-GLUPrunus persicagene
GLUAF435089.1-GLUPrunus persicagene
GLUAF435088.1-GLUPrunus persicagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GLUU49454.1-GLU.m1Prunus persicamRNA
GLUAF435089.1-GLU.m1Prunus persicamRNA
GLUAF435088.1-GLU.m1Prunus persicamRNA
GLUAJ002748.1-GLU.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
beta-1,3-glucanaseGLUPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database U49454.1-GLU scaffold_7:8592335..8593548
scaffold_7:8581254..8582563
U49454.1
gene parsed from NCBI nr database AF435089.1-GLU scaffold_7:8584000..8585698
AF435089.1
gene parsed from NCBI nr database AF435088.1-GLU scaffold_7:8581254..8582563
scaffold_7:8592335..8593548
AF435088.1
mRNA parsed from NCBI nr database U49454.1-GLU.m1 scaffold_7:8592335..8593548
scaffold_7:8581254..8582563
U49454.1
mRNA parsed from NCBI nr database AF435089.1-GLU.m1 scaffold_7:8584000..8585698
AF435089.1
mRNA parsed from NCBI nr database AF435088.1-GLU.m1 scaffold_7:8581254..8582563
scaffold_7:8592335..8593548
AF435088.1
mRNA parsed from NCBI nr database AJ002748.1-GLU.m1 scaffold_1:9112830..9112974
AJ002748.1

Sequence(s):
>U49454.1-GLU1213
atgactaaatcgaattcgtcatcagttggcagactcctttctctgatttccatagtacttctacttgggcagctggtggt
gggtagcttggcaacaaaacaacacacaggtatgcatatataattggcacctctgtcaatctaactgcaaattacgacat
ttttgtgtgtgtctattttaaagataaggaccaaactgttccatgcaacaaaccacgcatttctaatcaatctcacatgt
aagcaatattaattcctttttcaatgtaggtgctccaattggtgtatgtaatggaatggttggcgatgacctaccacccc
aagcagaagttgttgccctctacaagacaaataacatcccaagaatgcgactttatgatccaaacccagccgctctagaa
gcccttcgaggctccaatatcaagctcttgctaggcgtaccaaatgaaaaccttcaatacattgccttaagccaagccaa
cgcaaatgcatgggtccaaaacaatgtgagaaactatgccaatgtgaaattcaagtacattgcggtaggaaatgaagtca
agccttcagactcctttgcacagtttctcgtcccagccatgcgaaatattcaagaggcaatttctcttgctggtcttgca
aagaaaattaaagtttcgacagccatcgacaccggagtacttggagagacctttcctccttcgataggctcattcaagtc
tgaatataacgcccttttatatcccatcatccgcttcctagtgagccaccaatcgccattgcttgttaacttgtaccctt
attttgcttacagtggcaacactcaagacattcgtcttgactatgctcttttcacagctccatcagttgtggtacaagat
gggaactttggttaccgaaatcttttcgatgccatgttagatggtgtttatgctgctcttgagaaggctggtggagggtc
tttgaaagttgttatatcagagactggttggccatcagctgctggaacagccacaacaattgataatgcaaggactttta
tatcaaatttgattcaacatgtgaaggaagggactccaaggaggccaggaaggcccatagaaacttacatctttgccatg
tttgatgagaatagaaagaccccagagcttgagaaacattgggggctcttctccccaacaaaacagcctaaataccaaat
cagtttcaattga
back to top
>AF435089.1-GLU1709
atggctaaatccaattcgtcagtcggtagaggcccttcaatgatttcgatagtatttctacttgggctgctgatggctag
ctttgaaacaacaggtatatatctctggcaagattcgtccctattttggcttggaaggctacatagttttgatattctta
caaactttgaggctattaagggctaaaagggccgagctcgtatttgacaattatttatttatttttttactatagatctg
tgggaactgttgcctgatacttttcttttacacaattacttgatttttccaacgaacttctgtgttgcttccatgtctgg
gtcagggtggatggaaacaatgtgcaaaacagaatttaatagcttctacttaaacttcattttcatgtgcaaggttattg
ataagcgggggaagggaagaatgctgttgggttttactttttttcaattgaaaaattatttattatttattttgtccacg
tgtgtacgaaattacaaaaacacccatgtcacgtagtcaaaattaacaaatttttggacggagttgatgttggggggcaa
acaaggccaccaaaatacggtcaagcggggtaagtgagccactttgaatttcagagagcagtgtgagatttgaccgtagt
ttcaagggacattggtgtaaataggccttgaatatattcatgatcattttagcaacaaattatattgtataaatctagtg
aacttttcaccaggatcataaaacctcattataatttcttcaatattgcaggagcccagattggtgtatgttatggaatg
cttggagatcgtttaccacccccatcagaagttattgctctgtataagcaaaataacatcagaaggatgcgactgtatga
tccaaaccaggctgctctagcagcccttaaaggctcttatattgagctcatgctaggcgttccaaatgacaaccttcaaa
gcctagcctcaagccaggccaatgcaaatacttgggtccaaaacaatgtgagaaactatggcaatgtaagattcaaatac
attgcggtaggaaatgaagtcaagccctcagactcctatgcacaatttcttgtcccggccatgcaaaacattcagaacgc
aatttctagtgctggtttgggaattaaagtctccactgccgtagacactggagtgcttggaaattcctttcctccatcga
agggagagttcaagtccgaatatggagcacttttgaaccccatcatccgcttcctagtgaacaacagatcgccgttgctg
gttaatttgtacccgtatttcagctacagcagcaacactcacgacattcgtctagattatgctcttttcacagctccatc
agttgtggtacaagatggccaacgtggctatcgtaatcttttcgatgccattttggacgctgtttatgccgctcttgaga
aggcgggcggagggtctttggaaattgtcatatccgaaagtggttggccatcagctggtggaacggcaacaacaattgat
aatgcaaggacttataatgcaaatctgattcaacatgtgaagggagggactccaaggaagcccggaagggccatagaaac
ctacatctttgccatgtttgatgagaacagaaagaacccagagttggagaaacattgggggctgttttcaccaagcaaac
agccgaaatacccaatcaatttcaactga
back to top
>AF435088.1-GLU1309
atgactaaatcgaattcgtcatcagttggcagatgcctttctctgatttctatagtacttctacttgggcagctggtggt
ggctagcttggcaacaaaacaacacacaggtatgcatatataattggcactgctgtctgtcaatctaactgccaatttag
cttttgtttttctagcgtatgattcatctaactcgtgattaacgaaagccaatgcacaacaaataacgacatttttgtgt
gtgtctatttttaaaacataaggaccaaactgttccatgcaacaaaccacgcattcctaatcaatctcacataaggacca
aattggtgtgtctatttagcaatataaattcctttttcaatgtaggtgctccagttggtgtatgtaatggaatggttggc
gatgacctaccaccccaagcggaagttgttgccctctacaagacaaataacatcccaagaatgcgactttatgatccaaa
cccagccgctctagaagcccttcgaggctccaatatcaagctcttgctaggcgtaccaaatgaaaaccttcaatacattg
ccttaagccaagccaacgcaaatgcatgggtccaaaacaatgtgagaaactatgccaatgtgaaattcaagtacattgcg
gtaggaaatgaagtcaagccttcagactcctttgcacagtttctcgtcccagccatgcgaaatattcaagaggcaatttc
tcttgctggtcttgcaaagaaaattaaagtttcgacagccatcgacaccggagtacttggagagacctttcctccttcga
taggctcattcaagtctgaatataacgcccttttatatcccatcatccgcttcctagtgagccaccaatcgccattgctt
gttaacttgtacccttattttgcttacagtggcaacactcaagacattcgtcttgactatgctcttttcacagctccatc
agttgtggtacaagatgggaactttggttaccgaaatcttttcgatgccatgttagatggtgtttatgctgctcttgaga
aggctggtggagggtctttgaaagttgttatatcagagactggttggccatcagctgctggaacagccacaacaattgat
aatgcaaggacttttatatcaaatttgattcaacatgtgaaggaagggactccaaggaggccaggaaggcccatagaaac
ttacatctttgccatgtttgatgagaatagaaagacccccgagcttgagaaacattgggggctcttctccccaacaaaac
agcctaaataccaaatcagtttcaattga
back to top
>U49454.1-GLU.m11053
atgactaaatcgaattcgtcatcagttggcagactcctttctctgatttccatagtacttctacttgggcagctggtggt
gggtagcttggcaacaaaacaacacacaggtgctccaattggtgtatgtaatggaatggttggcgatgacctaccacccc
aagcagaagttgttgccctctacaagacaaataacatcccaagaatgcgactttatgatccaaacccagccgctctagaa
gcccttcgaggctccaatatcaagctcttgctaggcgtaccaaatgaaaaccttcaatacattgccttaagccaagccaa
cgcaaatgcatgggtccaaaacaatgtgagaaactatgccaatgtgaaattcaagtacattgcggtaggaaatgaagtca
agccttcagactcctttgcacagtttctcgtcccagccatgcgaaatattcaagaggcaatttctcttgctggtcttgca
aagaaaattaaagtttcgacagccatcgacaccggagtacttggagagacctttcctccttcgataggctcattcaagtc
tgaatataacgcccttttatatcccatcatccgcttcctagtgagccaccaatcgccattgcttgttaacttgtaccctt
attttgcttacagtggcaacactcaagacattcgtcttgactatgctcttttcacagctccatcagttgtggtacaagat
gggaactttggttaccgaaatcttttcgatgccatgttagatggtgtttatgctgctcttgagaaggctggtggagggtc
tttgaaagttgttatatcagagactggttggccatcagctgctggaacagccacaacaattgataatgcaaggactttta
tatcaaatttgattcaacatgtgaaggaagggactccaaggaggccaggaaggcccatagaaacttacatctttgccatg
tttgatgagaatagaaagaccccagagcttgagaaacattgggggctcttctccccaacaaaacagcctaaataccaaat
cagtttcaattga
back to top
>AF435089.1-GLU.m11032
atggctaaatccaattcgtcagtcggtagaggcccttcaatgatttcgatagtatttctacttgggctgctgatggctag
ctttgaaacaacaggagcccagattggtgtatgttatggaatgcttggagatcgtttaccacccccatcagaagttattg
ctctgtataagcaaaataacatcagaaggatgcgactgtatgatccaaaccaggctgctctagcagcccttaaaggctct
tatattgagctcatgctaggcgttccaaatgacaaccttcaaagcctagcctcaagccaggccaatgcaaatacttgggt
ccaaaacaatgtgagaaactatggcaatgtaagattcaaatacattgcggtaggaaatgaagtcaagccctcagactcct
atgcacaatttcttgtcccggccatgcaaaacattcagaacgcaatttctagtgctggtttgggaattaaagtctccact
gccgtagacactggagtgcttggaaattcctttcctccatcgaagggagagttcaagtccgaatatggagcacttttgaa
ccccatcatccgcttcctagtgaacaacagatcgccgttgctggttaatttgtacccgtatttcagctacagcagcaaca
ctcacgacattcgtctagattatgctcttttcacagctccatcagttgtggtacaagatggccaacgtggctatcgtaat
cttttcgatgccattttggacgctgtttatgccgctcttgagaaggcgggcggagggtctttggaaattgtcatatccga
aagtggttggccatcagctggtggaacggcaacaacaattgataatgcaaggacttataatgcaaatctgattcaacatg
tgaagggagggactccaaggaagcccggaagggccatagaaacctacatctttgccatgtttgatgagaacagaaagaac
ccagagttggagaaacattgggggctgttttcaccaagcaaacagccgaaatacccaatcaatttcaactga
back to top
>AF435088.1-GLU.m11053
atgactaaatcgaattcgtcatcagttggcagatgcctttctctgatttctatagtacttctacttgggcagctggtggt
ggctagcttggcaacaaaacaacacacaggtgctccagttggtgtatgtaatggaatggttggcgatgacctaccacccc
aagcggaagttgttgccctctacaagacaaataacatcccaagaatgcgactttatgatccaaacccagccgctctagaa
gcccttcgaggctccaatatcaagctcttgctaggcgtaccaaatgaaaaccttcaatacattgccttaagccaagccaa
cgcaaatgcatgggtccaaaacaatgtgagaaactatgccaatgtgaaattcaagtacattgcggtaggaaatgaagtca
agccttcagactcctttgcacagtttctcgtcccagccatgcgaaatattcaagaggcaatttctcttgctggtcttgca
aagaaaattaaagtttcgacagccatcgacaccggagtacttggagagacctttcctccttcgataggctcattcaagtc
tgaatataacgcccttttatatcccatcatccgcttcctagtgagccaccaatcgccattgcttgttaacttgtaccctt
attttgcttacagtggcaacactcaagacattcgtcttgactatgctcttttcacagctccatcagttgtggtacaagat
gggaactttggttaccgaaatcttttcgatgccatgttagatggtgtttatgctgctcttgagaaggctggtggagggtc
tttgaaagttgttatatcagagactggttggccatcagctgctggaacagccacaacaattgataatgcaaggactttta
tatcaaatttgattcaacatgtgaaggaagggactccaaggaggccaggaaggcccatagaaacttacatctttgccatg
tttgatgagaatagaaagacccccgagcttgagaaacattgggggctcttctccccaacaaaacagcctaaataccaaat
cagtttcaattga
back to top
>AJ002748.1-GLU.m1144
atgtttgatgagaataacaaactaggtgaagaaacagagagacactttggggtgttcttcccaactaaagagccaaagta
taacctcaatttcgatacttccgctgggtataatactacaaatacccttaacactgacatgtaa
back to top