GPS, GPS (gene) Fragaria x ananassa

Gene Overview
Name GPS
Gene Symbol GPS
Type gene
Organism Fragaria x ananassa
Synonym ADP-glucose pyrophosphorylase small subunit
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
GPSAY518343.1-GPS.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
ADP-glucose pyrophosphorylase small subunitGPSFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AY518343.1-GPS.m1 N/A AY518343.1

Sequence(s):
>AY518343.1-GPS.m11566
atggcttcctcttcaatggcagcgaacggtgttcccacgttgagactgtccacgtccaacattgccacgaatcaaaccca
gaaaacgaatagagggctttccttcagcggctctcatctatcgggcaccaaaatcccgactcctgccacgtgtttaagga
cctgtagtccttccccgtccaccagaagggccccactggtggtgtctccgaaagctgtttcggattccaagaactcggag
acgtgtcttgatcccgacgcgagcagaagtgtgttggggattatattgggaggcgacggacggacgaggctgtacccgct
gacgaagaagcgcgcaaagccggctgttccgttgggagcgaattaccggctgattgatattccggtcagcaactgcctca
acagcaacgtttccaagatctacgtcctcacccagttcaactccgcttctctcaatcgtcatctctctcgtgcttacgcc
agcaacatgggagggtacaagaacgaaggctttgtcgaggttctcgctgcgcagcagagtccggagaatcccaattggtt
ccagggtactgcggatgctgtgaggcagtgtttgtggctgtttgaggagcacaatgtgttggagtttttggttcttgccg
gggaccatttgtataggatggactatgagaagttcattcaggctcatagagagactgatgcggatatcactgtggctgct
cttcccatggatgagaagcgcgctactgccttcggtttgatgaagattgatgatgagggtcgcattattgagtttgctga
gaagcctaaaggggagcaactcaaagctatgaaggtagatacaaccatattgggtcttgacgatgagagagctaaagaga
tgccttacatcgccagtatgggtatatatgttgtgagcaaaaatgtgatgttagatctgcttcgtgagaaatttcctgga
gcaaatgattttgggagtgaagtcattcccggtgcaacttccatcggcttgagagttcaagcttatttgtacgatggcta
ctgggaagacatcggtaccattgaagctttctataatgccaatctgggaataactaaaaagccaattcctgatttcagct
tctacgatagttcatccccaatctatacccaacctcggtatttgcccccatccaaaatgcttgatgctgatatcacagat
agtgttattggcgaaggttgtgtgataaagaactgtaaaattcaccattctgttattgggcttcgttcttgcatatcgga
aggtgctgttattgaagacacattactgatgggggcagactactatgagacggatgtcgacaggaggctcatggctaaga
aaggctctgttccaattggtatcggaaagaattctcacattaagagagctataattgacaagaatgctcggattggggac
aatgtgaagattatcaagagtgacaatgtgcaagaaacagcaagagaaacggatggatatttcatcaaaagcgggattgt
cacagtgatcaaagatgcctggattcctagtggaactgttatctaa
back to top