HMG1, HMG1 (gene) Fragaria x ananassa

Gene Overview
Name HMG1
Gene Symbol HMG1
Type gene
Organism Fragaria x ananassa
Synonym 3-hydroxy-3-methylglutaryl-CoA reductase
FaHMGR1
Description NA
Comment HMGR
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
3-hydroxy-3-methylglutaryl-CoA reductaseHMGFragaria x ananassagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
HMG1AB360389.1-HMG1.m1Fragaria x ananassamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AB360389.1-HMG1.m1 LG2:10296035..10296427
AB360389.1

Sequence(s):
>AB360389.1-HMG1.m1393
gcttcacctaaagctgcccctaaagtgtttgaagagaaggcaatgatcgagaccccaccaccaactgaagaggacgaaga
gatcatcaaggctgtggtggctggaaccattccctcatactcactggaatcaaagctcggtgattgcaagagggcagctt
ctattaggcgcgaggctttacagagagttacaggcaagtctcttgagggtttgcctttggagggctttgattatgaatcc
attttgggtcaatgctgtgagatgccagttgggtatatcaccattcctgtagggattgctgggcctcttatgctcgatgg
aagagagttctcagttcccatggccacaactgagggttgcttggtggccagtaccaaccgtggcttgcaaagc
back to top