HMG1, HMG1 (gene) Malus x domestica

Gene Overview
Name HMG1
Gene Symbol HMG1
Type gene
Organism Malus x domestica
Synonym 3-hydroxy-3-methylglutaryl coenzyme A reductase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
HMG1AY043490.1-HMG1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
3-hydroxy-3-methylglutaryl-CoA reductaseHMGMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AY043490.1-HMG1.m1 Chr05:27470144..27472233
chr8:9747278..9749373
AY043490.1

Sequence(s):
>AY043490.1-HMG1.m11827
atggacgtccgaaggcgatcgacgatggatacacctgccaccaaggccagaagtgggccgatgaaggtgaaagtggtgga
ccacgagaacgacgttggtgtcgtcggggccaaggcctccgacgccctgccgctgccgttgtacctgactaacgccgtct
gcttcactctcttcttctccgtcgtctacttcctccttactcgttggcgcgagaagatcaagacctcgacgccgctccac
gtcgtgaacctctccgagatcgtcgcgatactcgcgttcgtcgcctccttcatctacttgctcggattcttcgggatcga
tttcgtgcagtcgctcattctccgccccagcaatgacgtctgggccgccgacgatgacgaggaggagcacgagcgcttga
tattgaaagacgacgcgcggaaagtgccgtgtggggccggactcgactgcagcccaattccccaaattgcctctgttgct
gctgccgcccccaaagctgttgcacagaaggtgtttgataaagaggtagtcctctccacttcctgcgatttcaccgccca
gccgttgacggaggaagatgaggaggtggtcaagtccgtggtggcgggaaccatcccttcctactctctggagtcaaagc
tcggagattgcaggagggcggcggctatcaggcgcgaggcgcttcagaggatcacaggaaagtctctgggtggtctgcca
ttggaggggttcgattacgagtcaattctgggtcagtgctgcgagatgccagttgggtatgttcagattccagttgggat
tgctgggcctcttatgctccatggcagagagttttccgtaccaatggccaccaccgaaggttgcttggttgccagcacca
accgtggcttcaaagctatcaacttgtccggcggagccaccagtgtgttgctgagagatgggatgaccagagcaccttgt
gtgaggttcaactctgctaagagagctgccgagttgaagttctacttggaagaacccaacaattatgacaccttgtccac
ggttttcaacaggtcaagcagattcggtaggcttcagacaattaagtgtgccattgctgggaagaacttgtacatgagat
tcacctgcagcaccggtgatgctatggggatgaacatggtctccaaaggtgtgcaaaacgtcttggatttcctccagaac
gacttccctgacatggatgtgattggaatttccggcaactactgctctgacaagaagcccgctgcggtgaactggattga
aggccgcggaaaatcggtggtctgtgaggctgtgatcaagggtgatgtggtgcagaaggtgttgaaaaccaatgtggcgt
ccctgtgcgagcttaacatgcttaagaaccttactgggtctgcaatggctggagccctcggtggattcaacgcacatgcc
agcaacatcgtctccgccatctacatcgctaccggccaagacccagctcagaatgtggagagttctcactgcattaccat
gatggaacccatcaatgatggacaggaccttcacgtgtctgtcaccatgccttcaattgaggttggtactgttggaggtg
ggacccaacttgcatctcaatcagcttgtctgaaccttcttggagtgaagggtgctaacagggaggcaccaggatcaaat
gcaagattgttggccactgttgtggctggttctgttcttgctggagagctttctctcatgtctgctatctcagctggaca
gcttatgaatagtcacatgaaatactacagatcaagcaaagatgtctcagctgttgcatccgcttaa
back to top