HMG2, HMG2 (gene) Malus x domestica

Gene Overview
Name HMG2
Gene Symbol HMG2
Type gene
Organism Malus x domestica
Synonym 3-hydroxy-3-methylglutaryl-CoA reductase
Description NA
Comment initiates mevalonic acid pathway, converting HMG-CoA to mevalonic acid
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
3-hydroxy-3-methylglutaryl-CoA reductaseHMGMalus x domesticagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
HMG2EF580921.1-HMG2.m1Malus x domesticamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly EF580921.1-HMG2.m1 Chr15:18530735..18534290
chr9:7671185..7674740
EF580921.1

Sequence(s):
>EF580921.1-HMG2.m11710
atggcagttcgccggcgaccctcaaccgcctctgccgccggcgaacccattaagtccgacaagcagctgcttaaggcctc
cgacgcccttcccctcccgctctacctcaccaatggcctcttcttcacgctcttcttcaccgtcgcctacttcctcctca
cccgctggcgagagaagatccgcagctccacgccacttcacgtcgtcacgctctctgagctcgccgccctcttctccctc
ttcgcctccgttatctacctactcggcttcttcggcattgacttcgtccagtccttcgtctcccccagctcccgcgccgc
ccacgatccctggaaagacgacgttgtagtccagcgaaaaaaatccgtaaatgccagcgcactcctttcctccacctccg
ccgctacaaccaccgcaaccgccatcgacgataattcgccggcgttgtcgaccgatgacgaggaaattatcacgtctgtc
gtcgtcggaaccacgccgtcatactctctcgagtccactctcggggactgccggcgagctgctgcgatacggcgagaggc
tctgcagcggacaaccggtagttcgctggtggggctcccgctggaaggcttcgactacgaggcgatactggggcagtgct
gcgagatgccggtcgggtacgtccagatcccggcgggagtggcggggccgctgctgatcgacgacgaggagtacacggtg
ccaatggcgacgacggagggatgcttggttgccagcaccaataggggctgcaaggccatccacatgtcaggcgtggccgg
tagcgtggttctcaaggacgggatgacccgagctcccgttgtccggttcagctcagccgtcagagctgccgaactcaagt
tcttcgtcgaggacccgctcaacttcgattccctcgctgtcgtgttcaacagatctagtagatttgcaaagcttcagagg
attcaatgctcgatggcagggaagaatttgtacatgaggtttacttgcagcactggagatgcaatggggatgaacatggt
ctccaaaggcgcccaaaacgttctagatctcctccaaatcgacttccctgacatggatgttattggcatctctggaaact
tttgctccgacaagaaaccggccgcggtgaattggatagaagggagaggcaagtcagtagtgtgtgaagcagtgatcaag
gaagaggtggtgaggaaggtactgaagaccaatgtggctgccttggtggagctcaacatgctcaaaaacctaactggttc
tgccatggctggtgctctcggcgggttcaatgcccacgccagcaacattgttgctgcgatctacatcgccacaggtcagg
atccggctcagaatgtagagagctctcactgcatcaccatgatggaagccataaacgacggcaaggaccttcatgtctca
gtcaccatgccttccattgaggtgggaacagttggaggaggaacccagcttgcatcccaagcagcctgcttgaacctgct
gggtgtaaagggtgcaagcagagactcgcccggttcaaactctaggaaattggccaccattgtagccggttcagtgctcg
ccggagagctctcgctgatgtcagcaattgcagctggacagctggtcaatagccacatgaaatacaacagatctagcaag
gatgtctcaaaacttgccggcccccgctaa
back to top