HMG3, HMG3 (gene) Malus x domestica

Gene Overview
Name HMG3
Gene Symbol HMG3
Type gene
Organism Malus x domestica
Synonym 3-hydroxy-3-methylglutaryl coenzyme A reductase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
3-hydroxy-3-methylglutaryl-CoA reductaseHMGMalus x domesticagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
HMG3AY043491.2-HMG3.m1Malus x domesticamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AY043491.2-HMG3.m1 Chr02:8742014..8744240
chr2:8562395..8564622
AY043491.2

Sequence(s):
>AY043491.2-HMG3.m11140
aaacgcggttcgttcgctggagggcctgccgtggagggattcgattatcggtcgatactgggacagtgctgtgagaatcc
ggtggggtatgtgcagatcccggtgggagtcgccggaccgctgcttctcgacggagaagagtacatggtgccaatggcga
caacggaggggtgcctggtggccagcaccaataggggattcaaggcaatctacgcctcaggcggcgccgagagtgtcctc
ttcaacgactccatgaccagagctccaattgtgaggttccactccgtcgttagggctgctcagctcaagttcttcgtcga
gaaccctctcaattttgatgctctcgccgtcgttttcaacatgtctagcagatttgcaaagctcgaaaagattcgatgcg
cgatagcaggcaggaatctgtacctaaggttttcatgcagcactggagatgccatggggatgaacatgatctccaaaggc
gtccaatgtgttatcgaattccttcaaaatgaattcccagacatggaagttgttggcatctctggaaacttctgctcaga
caagaaagcagcagccgtaaattggattgaagggcgagggaaatcagtaacttgcgaggcagtcatcaaggaggaattgg
tgaggaaagtactgaaaaccgatgtggattcccttgtgaagcttaacgtgaataaaaaccttgttgggtctgccatggct
ggtgctcttggcgggttcaacgcccacgccagcaatattgtctctgcagtcttcatagccactggccaggaccctgctca
gaatattgagagctctcactgcattaccttgatggaagccgacggcaatgaccttcatatctcagtcaccatgccttcca
ttgaggtgggtacagttggaggaggaacacaactcgcatcccaatcagcctgcttgaacttgctcggtgtcaagggcgca
ggcaaagactctccaggtttaaactcaaggcaactggcgagaattgtagctggagctgtcctagcaggggagctttctct
catgtcagccatcgcatccgggcagctagtgaagagccacatgaaatacaaccgatctaacccagacgttgcaaaccttg
cctcggtaaaacaccggtag
back to top