HMG, HMG (gene) Malus x domestica

Gene Overview
Name HMG
Gene Symbol HMG
Type gene
Organism Malus x domestica
Synonym 3-hydroxy-3-methylglutaryl coenzyme A
3-hydroxy-3-methylglutaryl-CoA reductase
3-hydroxy-3-methylglutaryl coenzyme A reductase
HMGR
Description NA
Comment HMGR
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
HMGAF495909.1-HMGMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
HMGAF495909.1-HMG.m1Malus x domesticamRNA
HMGAY347850.1-HMG.m1Malus x domesticamRNA
HMGAY039230.1-HMG.m1Malus x domesticamRNA
HMGAF316112.1-HMG.m1Malus x domesticamRNA
HMGAF315713.1-HMG.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
3-hydroxy-3-methylglutaryl-CoA reductaseHMGMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AF495909.1-HMG Chr05:27468762..27470419
chr8:9749098..9750748
AF495909.1
predicted genes from whole genome assembly AF495909.1-HMG.m1 Chr05:27470144..27470419
chr8:9749098..9749373
AF495909.1
predicted genes from whole genome assembly AY347850.1-HMG.m1 Chr02:8742490..8743466
chr2:8563169..8564146
AY347850.1
predicted genes from whole genome assembly AY039230.1-HMG.m1 Chr05:27470144..27472233
chr8:9747278..9749373
AY039230.1
predicted genes from whole genome assembly AF316112.1-HMG.m1 Chr15:18530735..18531679
chr9:7671185..7672129
AF316112.1
predicted genes from whole genome assembly AF315713.1-HMG.m1 Chr05:27470204..27472233
chr8:9747278..9749313
AF315713.1

Sequence(s):
>AF495909.1-HMG1658
aaaaattaaaatataacttgtacttcatatagttgtcaaattgtaacttatttagttggttgatgcaagggtgtcttcga
gtgagatagatttgagctggtgaagctttttttctttgaccaaatgatgttatctacactaacggggtggggagtgggga
gtgggtaagcttcacaataggctagcgataatatgattcaaatttatctttgataagaattgaacataagacctctcact
tacaaataaaaaagaatatcattagaccgtaatactaagtggccgatgaagctttttaatcttcttgttgaagatgtcaa
tgtatggttcacattaacaaattataaatagtgattatcatttgaggaaaaaaaacgtgtatgagaatattgtgcgtatt
ttacctagtaaattaatagagataagaacacgagagattacttttaagaaaatatcttatttttgggcaaataagaggaa
aaaataggatttccacttctacatcacatagtaaaagacgaaaattataaatgtatacaggatattaatatttaatactc
aaaatgcttttttggttcgcagattttacaaatctggctttcgatgaaatcttgtttccaaaaccatgggcatgaatcaa
gatttaatagaaagttggcatgcttactatctttcaccaaagaaagaaaattggcatgctaaactttaggccaattattg
taagtttagtcattcatgcacgcatgtaatcatataacgaaatgccttctgaaaaagcacttcgatattaagatccgtta
aacttgctaaattcaattgctgtaagtagcgttcgagtcattcctccttaccaatacatcctatccataattacgttgat
aaccgtgctatgttatgctcaacgcatctatgactgacagtcccaaaaataactcaagcagataaagacaaacaaccaac
caaccaatatagaaattaaaaaaaaaactattttcttaccaaaaattaaaataatttgtaaaaaaaaaaatctaaaatct
aaaattaatgagagagcaaagcaagaaagaaagtggtaggaaagagacaaaaagaggtgcattcctttgactgtttatta
tatgccatgtaagtcctacacgtggtcgtcgcttcgaacgcgtacgccagcccacctcctatataaaccccgcctatgca
ctcgctccaccattcaaatcaacccaccaacaaattaaaaacaaatgtttattcaatcattttttgtgagtttccggttt
tgcccacagaagcctcagtccccgctgtcctttcctcttctctcctccgccgctcgatcgccgccggcgcattttagcat
caccaaccgcgtcaacacatacgatggacgtccgaaggcgatcgacgatggatacacctgccaccaaggccagaagtggg
ccgatgaaggtgaaagtggtggaccacgagggcgacgttggtgtcgtcggggccaaggcctccgacgccctgccgctgcc
gttgtacctgactaacgccgtcttcttcactctcttcttctccgtcgtctacttcctccttactcgttggcgcgagaaga
tcaggacctcgacgccgctccacgtcgtgaacctttccgagatcgtcgcgatactcgc
back to top
>AF495909.1-HMG.m1275
atggacgtccgaaggcgatcgacgatggatacacctgccaccaaggccagaagtgggccgatgaaggtgaaagtggtgga
ccacgagggcgacgttggtgtcgtcggggccaaggcctccgacgccctgccgctgccgttgtacctgactaacgccgtct
tcttcactctcttcttctccgtcgtctacttcctccttactcgttggcgcgagaagatcaggacctcgacgccgctccac
gtcgtgaacctttccgagatcgtcgcgatactcgc
back to top
>AY347850.1-HMG.m1165
ccagacatggaagttgttggcatctctggaaacttctgctcagacaagaaagcagcagccgtaaattggattgaagggcg
agggaaatcagtaacttgcgaggcagtcatcaaggaggaagtggtgaggaaagtactgaaaaccgatgtggattcccttg
tgaag
back to top
>AY039230.1-HMG.m11827
atggacgtccgaaggcgatcgacgatggatacacctgccaccaaggccagaagtgggccgatgaaggtgaaagtggtgga
ccacgagggcgacgttggtgtcgtcggggccaaggcctccgacgccctgccgctgccgttgtacctgactaacgccgtct
tcttcactctcttcttctccgtcgtctacttcctccttactcgttggcgcgagaagatcaggacctcgacgccgctccac
gtcgtgaacctttccgagatcgtcgcgatactcgcgttcgtcgcctccttcatctacttgctcggattcttcgggatcga
tttcgtgcagtcgctcattctccgccccagcaatgacgtctgggccgccgacgatgacgaggaggagcacgagcgcttga
tattgaaggacgacgcccggaaagtgccgtgtggggccggactcgactgcagcccaattccccaaattgcccctgttgct
gctgccgcccccaaagctgttgcacagaaggtgtttgataaagaggtagtcctctccactccctgcgatttcaccgccca
gccgttgacggaggaagatgaggaggtggtcaagtccgtggtggcgggaaccatcccttcctactctctggagtcaaagc
ttggagattgcaggagggcggcggctatcaggcgcgaggcgcctcagaggatcacaggaaagtctctgggtggtctgcca
ttggaggggttcgattacgagtcaattttgggtcagtgctgcgagatgcccgttgggtatgttcagattccagttgggat
tgctgggcctcttatgctcgatggcagagagttttccgtaccaatggccaccaccgaaggttgcttggttgccagcacca
accgtggcttcaaagctatcaacttgtccggcggagccaccaatgtgttgctgaaagatgggatgaccagagcaccttgt
gtgaggttcaactctgctaagagagctgccgagttgaaattctacttggaagaacccaaaaattatgacaccttgcccac
ggttttcaacaggtcaagcagattcggtaggcttcagacaattaagtgtgccattgctgggaagaacttgtacatgagat
tcacctgcagcaccggtgatgntatggggatgaacatggtctccaaaggtgtgcaaaacgtcttggatttcctccagaac
gacttccctgacatggatgtgattggaatttccggcaactactgctctgacaagaagcccgctgcagtgaactggattga
aggccgcggcaaatcggtggtctgtgaggctgtgatcaagggtgatgtggtgcagaaggtgttgaaaaccaatgtggcgt
ccctgtgcgagcttaacatgcttaagaaccttactgggtctgcaatggctggagccctcggtggattcaacgcacatgcc
agcaacatcgtctccgccatctacatcgctaccggccaagacccagctcagaatgtggagagttctcactgcattaccat
gatggaacccatcaatgatggacaggaccttcacgtgtctgtcaccatgccttcaattgaggttggtactgttggaggtg
ggacccaacttgcatctcaatcagcttgtctgaaccttcttggagtgaagggtgctaacagggaggcaccaggatcaaat
gcaagattgttggccactgttgtggctggttctgttcttgctggagagctttctctcatgtctgctatctcagctggaca
gcttgtgaatagtcacatgaaatacaacagatcaagcaaagatgtctcagctgttgcttccgcttaa
back to top
>AF316112.1-HMG.m1303
gagcctatcgacggcaaggaccttcatgtctcagtcaccatgccttccattgaggtgggaacagttggaggaggaaccca
gcttgcatcccaagcagcctgcttgaacctgctgggtgtaaagggtgcaagcagagactcgcccggttcaaactctagga
aattggccaccattgtagccggttcagtgctcgccggagagctctcgctgatgtcagcaattgcagctggacagctggtc
aatagccacatgaaatacaacagatctagcaaggatgtctcaaaacttgccggcccccgctaa
back to top
>AF315713.1-HMG.m11767
atgaaggtgaaggtggtggaccacgagaacgacgttggtgtcgtcggggccaaggcctccgacgccctgccgctgccgtt
gtacctgactaacgccgtcttcttcactctcttcttctccgtcgtctacttcctccttactcgttggcgcgagaagatca
ggacctcgacgccgctccacgtcgttaacctttccgagatcgtcgcgatactcgcgttcgtcgcctccttcatctacttg
ctcggattcttcgggatcgatttcgtgcagtcgctcattctccgccccagcaatgacgtctgggccgccgacgatgacga
ggaggagcacgagcgcttgatattgaaggacgacgcccggaaagtgccgtgtggggccggactcgactgcagcccaattc
cccaaattgcccctgttgctgctgccgcccccaaagctgttgcacagaaggtgtttgataaagaggtagtcctctccact
ccctgcgatttcaccgcccagccgttgacggaggaagatgaggaggtggtcaagtccgtggtggcgggaaccatcccttc
ctactctctggagtcaaagcttggagattgcaggagggcggcggctatcaggcgcgaggcgcttcagaggatcacaggaa
agtctctgggtggtctgccattggaggggttcgattacgagtcaattttgggtcagtgctgcgagatgcccgttgggtat
gttcagattccagttgggattgctgggcctcttatgctcgatggcagagagttttccgtaccaatggccaccaccgaagg
ttgcttggttgccagcaccaaccgtggcttcaaagctatcaacttgtccggcggagccaccagtgtgttgctgagagatg
ggatgaccagagcaccttgtgtgaggttcaactctgctaagagagctgccgagttgaaattctacttggaagaacccaaa
aattatgacaccttgtccacggttttcaacaggtcaagcagattcggtaggcttcagacaattaagtgtgccattgctgg
gaagaacttgtacatgagattcacctgcagcaccggtgatgctatggggatgaacatggtctccaaaggtgtgcaaaacg
tcttggatttcctccagaacgacttccctgacatggatgtgattggaatttccggcaactactgctctgacaagaagccc
gctgcagtgaactggattgaaggccgcggcaaatcggtggtctgtgaggctgtgatcaagggtgatgtggtgcagaaggt
gttgaaaaccaatgtggcgtccctgtgcgagcttaacatgcttaagaaccttactgggtctgcaatggctggagccctcg
gtggattcaacgcacatgccagcaacatcgtctccgccatctacatcgctaccggccaagacccagctcagaatgtggag
agttctcactgcattaccatgatggaacccatcaatgatggacaggaccttcacgtgtctgtcaccatgccttcaattga
ggttggtactgttggaggtgggacccaacttgcatctcaatcagcttgtctgaaccttcttggagtgaagggtgctaaca
gggaggcaccaggatcaaatgcaagattgttggccactgttgtggctggttctgttcttgctggagagctttctctcatg
tctgctatctcagctggacagcttgtgaatagtcacatgaaatacaacagatcaagcaaagatgtctcagctgttgcatc
cgcttaa
back to top