ACO1, KM030036.1-ACO1.m1 (mRNA) Prunus salicina

Transcript Overview
Unique NameKM030036.1-ACO1.m1
OrganismPrunus salicina ()
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
ACO1ACO1Prunus salicinagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
KM030036.1-ACO1.m1-cds1KM030036.1-ACO1.m1-cds1Prunus salicinaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
ACO1KM030036.1-ACO1.p1Prunus salicinapolypeptide

Cross References
External references for this mRNA
Feature NameTypeLocationAnalysis
KM030036 region KM030036:1..960+ NCBI Rosaceae gene and mRNA sequences
scaffold_3 supercontig scaffold_3:16205609..16206881- Prunus persica Whole Genome v1.0 Assembly & Annotation
Property NameValue
Product1-amino-cyclopropane-1-carboxylic acid oxidase
The following sequences are available for this feature:

mRNA sequence

>KM030036.1-ACO1.m1 ID=KM030036.1-ACO1.m1|Name=ACO1|organism=Prunus salicina|type=mRNA|length=960bp
back to top

protein sequence of ACO1

>KM030036.1-ACO1.p1 ID=KM030036.1-ACO1.p1|Name=ACO1|organism=Prunus salicina|type=polypeptide|length=319bp
back to top

mRNA from alignment at KM030036:1..960+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>KM030036.1-ACO1.m1 ID=KM030036.1-ACO1.m1|Name=ACO1|organism=Prunus salicina|type=mRNA|length=960bp|location=Sequence derived from alignment at KM030036:1..960+ (Prunus salicina)
atggagaacttcccaatcatcaacttggagggcctcgatggagagggaag gaaagcaacaatggaaaaaatcaaagatgcctgtgagaactggggcttct ttgagcttgtgagtcatgggataccaactgagtttttggacacagtggag aggttgacaaaagaacactacaggcagtgcttggagcagaggttcaagga gctggtagccagcaagggccttgaggctgtcaagacagaggtcaatgata tggactgggaaagcaccttctacttgcgccatcttccaaaatctaacata tctgaagttccagatcttgaggatcagtacaggaatgtgatgaaggaatt tgcattgaagttggagaaattagcagagcagctcctagacttgctctgtg agaatcttggacttgaacaagggtacctcaagaaggccttctatggaaca aatggaccaacttttggcaccaaggttagcaactaccctccttgtcccaa ccctgagctgatcaagggtctccgggctcacaccgatgccggtggcctca tcctgctcttccaggatgacaaggtcagtggtctgcagctcctcaaggat ggccaatggattgatgtgccccccatgcgccactccattgttatcaacct tggtgaccaacttgaggtgatcactaacgggaagtacaagagtgtggagc acagagtgattgcccaaactgatggcaccagaatgtcaatagcttccttc tacaaccctggcagtgatgctgtcatctaccctgcaccaacactggtgga gaaagaagcagaggagaagaatcaagtgtacccgaaattcgtgttcgaag actacatgaagctctatgctagcgtcaagttccagcccaaagagccaaga tttgaagccatgaaagcagtggaaaccaatatcagtttgggtccaattgc aacagcttaa
back to top

Coding sequence (CDS) from alignment at KM030036:1..960+

>KM030036.1-ACO1.m1 ID=KM030036.1-ACO1.m1|Name=ACO1|organism=Prunus salicina|type=CDS|length=960bp|location=Sequence derived from alignment at KM030036:1..960+ (Prunus salicina)
back to top