HSF1, HSF1 (gene) Malus x domestica

Gene Overview
Name HSF1
Gene Symbol HSF1
Type gene
Organism Malus x domestica
Synonym HSF domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
HSF1HM122597.1-HSF1.m1Malus x domesticamRNA
HSF1HM122589.1-HSF1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Heat shock factorHSFMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122597.1-HSF1.m1 Chr14:8530890..8534517
chr14:10991253..10994877
HM122597.1
predicted genes from whole genome assembly HM122589.1-HSF1.m1 Chr16:1246391..1248406
chr10:1456138..1458153
chr10:1789382..1791397
HM122589.1

Sequence(s):
>HM122597.1-HSF1.m1648
atgctggtggaggatccggcgacggacgatgtgatatcctggaacgacgatgggtcggcgttcgtggtgtggcagacggc
ggaatttgcccgggatctcctcccaacactcttcaagcatagtaacttctctagctttgtcaggcagctaaatacttatg
gatttcgcaaagttgccacaaacaggtgggagttctgcaacgacaagttccgaaagggcgaaaaggatcagctatgtgac
atccgtagaagaaaagcatgggccaccaaacaacagccgatcaacaatgcagtaacccaacaagctggagcagctgcact
actaccaaatgagtttgatgaagaccaaaggtcctcctcaacttcatcatcatccgagttcagctctctcgtcgacgaaa
acaaaaggctgaagcaggagaacggggttttgagctcggagctgacgagcatgaaacggaagtgcaaggagcttcttgac
ttggtggcaaagtatggagactcggctgagaaagaggaggaagataatgaaagagtgctaaagttgtttggagtgagatt
ggaggttactggagagagggagaggaagagaaagagagctgaaattagtgcaaccgcaaacgttttactatctcaagcat
gcaaataa
back to top
>HM122589.1-HSF1.m11245
atggtgaaatcggcggagaagggcggaggagatgggtctgggccgtcggggtcggtgcctccttttctcagaaaatgcta
cgagatggtggatgacaaggacagcgacagtataatctcgtggagtgaagccggcgacagctttgcgatactggacatgg
cccagttctcgatttcaatgctgcccaagtatttcaagcacagcaacttttctagcttcatgaggcagctcaatatctat
ggatttagaaaaatagatccagatcgttgggtgtttgcaaatgaaggatttattcgaggtcaaaagcatttgttgaagaa
tattgctagaaggaaacatccacagggcacagatcaaaaaaagatattacagcaaaaagacaatcctgatataccgtctg
aaaatattagtgaaaatggtctgtggaaggaagttgagaacttgaagactgataaagttgctctgaagcaagagttggtg
aagcttaggcagcaccaggaaatttcacaaaataaattgctcctcctgaggaaccgccttcgcggaatggagaaaaatca
acagcagatgctgtcatttctagtgatggccatgcaaagtcctggatttctagttcagcttcttcatccaaaggaaaata
gttggcgaattgctgaagctggcaatataatagaacagtgtatggatgatgatagaccagtggcttctgatggtgcgata
gtgaggtaccaaccaccgatgattgaagccccaaagcctttagtcccaccgaattcaggctcagagaaacaacctgaagt
tgatgcttatatggatggaatggaagattttgttgtaaatcctgatttcatgaaaatgctaatggatgaaaagttgagcc
ctgtagaaacccatgccccatatactctaccagatatatctgacgatggtgcatgggagcagtttcttttagctagtcct
ttcttagaaaatattgaaggtacaaaggaagatggcgaagagcctgctgatgctagaatggaggtggaaccaatagtatc
tgatctggatgaatcacaaaattttgattatttagtcgagcaaatgaagaaatctcagaactttgcatcggattcaacag
ttgatggatctaatatggagagctctcaaaacttggagtttattactgaacaaatgggacatttggcttctgactctaac
aacatggaacagaatcagggaagcagaaggacaacttctgtgtaa
back to top