HSF5, HSF5 (gene) Malus x domestica

Gene Overview
Name HSF5
Gene Symbol HSF5
Type gene
Organism Malus x domestica
Synonym HSF domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
HSF5HM122593.1-HSF5.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Heat shock factorHSFMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122593.1-HSF5.m1 Chr17:27815760..27816750
chr17:17422689..17423679
chr17:19020380..19021370
HM122593.1

Sequence(s):
>HM122593.1-HSF5.m1990
atgcagaatcacgagtatacagttgctttaagtgatacagagagagaagaatatgagaagaaaatcagtagactgaatca
tgataaaagcttgcttgagttggagctacagcggcatcaaagagagaatcaggagtttgaatttcaagtacagatattac
gagaacaactgcagaacatggagaatcggcagaagcaatatacggccttcttggctcaactagtgcagaaaccgggattt
gcttctgtacttgtgcagcagtcagaaatccatagcaaaaagagaagattactgaattcaaacaactttcctgatgactt
tggtatggaaggtttgaatctgaatccgcagaaagaaaatttgggatcaatttcaactcccataataaagttggaccagc
ttgagacgatggagtcttccttaaacttttgggaagattttctacatgggattggggaagcaatgcccgaagatgtaaat
gatattggcccgttgtctcaggcctctcctatcattgttaccgaaacacaagacaccagcttgaatagcaggccttgctc
acctagatcacatttatcttcaccgaattcaatgaatgctcattcattcccagaggtggcggctgggtctgcaaatattc
ttgacatcctttctataacatcaatgttccccactgttgatttcaggtctaaatcttcaggaatcgatatgaactctaag
cccgacagtgcccctgcacttgccaaagaaatggtagtggaactggaagtgaaaaatgccgagcctaccaaggcaaatga
tgtattttgggaacaatgcctaacagagacccctggtttagctgatgcgctggaagtacactcagaaagaagggatggcg
atggcaaagcgagcgatgccaatccggctatccagaaaaagcactggtggaacacagataatgtcgataacttcaccaac
caaatagggcgcctcactccagctacataa
back to top