HSF8, HSF8 (gene) Malus x domestica

Gene Overview
Name HSF8
Gene Symbol HSF8
Type gene
Organism Malus x domestica
Synonym HSF domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
HSF8HM122596.1-HSF8.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Heat shock factorHSFMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122596.1-HSF8.m1 Chr15:5510687..5511956
chr15:2337890..2339159
chr15:2337891..2339160
HM122596.1

Sequence(s):
>HM122596.1-HSF8.m11152
atggcgttgatgatagacaactgcgagggcatactgctctctctggactcccacaagtcggtcccggcgccgttcctgac
caaaacctaccagctcgtcgacgaccccgccaccgaccacatcgtctcgtggggcgacgacgacaccaccttcgtcgtct
ggcgccctcccgagttcgcccgcgacctcctccccaactacttcaagcacaacaacttctcaagcttcgtccgccagctc
aacacctatggttttaggaagattgtaccggacagatgggagtttgcgaacgagttcttcaaaaagggagagaagcattt
gctttgcgagatccaccggagaaaaacagctcagccacatcaggtgggtctcagccaccaccaccaccaccactcccaac
tcggcatgaacggccaccaccaccatcctggctttttccccttcccaagtcccggcagcatctcgccctccgactcggac
gagcagcccaactggtgcgattcggactcccctcctctcttatccccaacgggaggtattaacacaaacattaactctaa
caacaataatttcatgaatattaacaataataataccacggtggcgggtttggcggaggacaacgagaggctgcggagga
gcaacaccatgctaatgtctgagctggcacatatgagaaaactctacaacgacatcatctactttgttcagaaccatgtc
aagccggtggctccgagcaactcatacccttcttccatgcttctctgcaacccacagcctcctaaacataatggtcctaa
tagtaatttgaaccaacttctagggtactatccggctgctcctccacctaatgccaaacaaaaccctcatcatatcatga
actcttccagtccgatgagcaacaccacgtcgaagagctcctccgtcactattctcgaagaccatcaccagcagcctccg
agcggtaacaatgggtgcaagaacactaagctttttggggtgccgctgcttcattcgaagaaacgattgcacccggagga
gtacggctcgaataatcaccatgggaacaacatgatggaggccagcaaggctcgtttgattttggagaaggatgatttag
gactccacctcatgcctccatccagatgttag
back to top