IAA14L, IAA14L (gene) Malus prunifolia

Gene Overview
Name IAA14L
Gene Symbol IAA14L
Type gene
Organism Malus prunifolia
Synonym indole-3-acetic acid 14 transcription factor like
IAA14
like
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Indole acetic acid-induced proteinIAAMalus prunifoliagene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
IAA14LAB469200.1-IAA14L.m1Malus prunifoliamRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AB469200.1-IAA14L.m1 Chr13:18556503..18558847
chr13:21624957..21627301
chr13:24036872..24039216
AB469200.1

Sequence(s):
>AB469200.1-IAA14L.m1732
atgatgagcatgcttggagttgagcgtgatctgaacctccgagaagctgagctgtgcctagggctgcccggtggcggtac
tactactgtggccgagccggagactgccaagactactggaaagagagggttctcggagaccattgatctcaagctcaacc
ttcagtccaaggaagatctgaatgacaatgtaaaaaatattgcttccaaggacaaaaacaactttctttcttgcacaaaa
gatccatcaaagcctccagccaaggcacaagttgtgggttggccaccagttcgatcataccgaaagaacgtaatggcgca
aaagaataccagcgaggaaaaaactaagaaggcaagcgcgggtggctgcaccgctgcgtttgtgaaggtttgcatggatg
gcgctccatatctccgtaaggtagatttgaagatgtacaggagctaccaagagctctctaatgccttagccaagatgttc
agttccttcaccaccggttactatggggaccaaggaatgatagacttcatgaatgagagcaagctgatggatcttcttaa
cagttctgagtatgtgccgacctatgaagataaggatggtgattggatgctcgtgggtgatgttccatgggggatgttgg
ttgattcatgcaagcgcttgcgaataatgaaaggatcagaagcaattggaattgccccaaaagctatggagaaatgcaag
ggcagaagctga
back to top